From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02101
  • pan locus tag?: SAUPAN004902000
  • symbol: SAOUHSC_02101
  • pan gene symbol?: vraU
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02101
  • symbol: SAOUHSC_02101
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1975337..1975723
  • length: 387
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAACTATGTTGAACGTTATATTGAACAGTTTTTGAGAGCAACAGTAAGAAATAATATC
    AAGCACTACCTTTTAATGCTAGATGAAAAAATGAAAAATTTAGATGATTATATGCGTTAT
    TTAATTACTAAAAAAGAACAACTTAGCAAGTTAATTGACAGTCTAATGCTAACATTAGAA
    AATAAATATATTGATATTGCTGAAGCATTTCAAATTCAATGTGCAAGAGAAATCAATAAT
    CAAGAAATTGAAAATATTAAATCAGAGTTGAATAAAGTTGAAGCATATTATGCACAAATT
    GAAACTCAAATTCAACAAACTTCAACTGAAAAAATAGCAACAGAAAAAACATCGTATCTA
    ATAAATTATATGAACGCTGTGGCATAG
    60
    120
    180
    240
    300
    360
    387

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_02101
  • symbol: SAOUHSC_02101
  • description: hypothetical protein
  • length: 128
  • theoretical pI: 4.98573
  • theoretical MW: 15289.5
  • GRAVY: -0.490625

⊟Function[edit | edit source]

  • TIGRFAM:
    two transmembrane protein (TIGR04527; HMM-score: 15.6)
    flagellar export protein FliJ (TIGR02473; HMM-score: 12.9)
    and 1 more
    Genetic information processing Protein fate Protein folding and stabilization prefoldin, alpha subunit (TIGR00293; HMM-score: 11.9)
  • TheSEED  :
    • Uncharacterized protein SAV1887
  • PFAM:
    no clan defined DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 15.7)
    Fusion_gly (CL0595) Baculo_F; Baculovirus F protein (PF12259; HMM-score: 14.4)
    no clan defined DUF1978; Domain of unknown function (DUF1978) (PF09321; HMM-score: 14.2)
    DAPDH_C; Diaminopimelic acid dehydrogenase C-terminal domain (PF16654; HMM-score: 13.9)
    DUF4795; Domain of unknown function (DUF4795) (PF16043; HMM-score: 13.7)
    and 6 more
    FliD_C; Flagellar hook-associated protein 2 C-terminus (PF07195; HMM-score: 12.3)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 12.2)
    no clan defined ApoO; Apolipoprotein O (PF09769; HMM-score: 11.5)
    Mer2; Mer2 (PF09074; HMM-score: 10.8)
    SKA2; Spindle and kinetochore-associated protein 2 (PF16740; HMM-score: 10.3)
    GAG-polyprotein (CL0523) Retrotrans_gag; Retrotransposon gag protein (PF03732; HMM-score: 9.2)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000789
    • TAT(Tat/SPI): 0.000078
    • LIPO(Sec/SPII): 0.000162
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNYVERYIEQFLRATVRNNIKHYLLMLDEKMKNLDDYMRYLITKKEQLSKLIDSLMLTLENKYIDIAEAFQIQCAREINNQEIENIKSELNKVEAYYAQIETQIQQTSTEKIATEKTSYLINYMNAVA

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.0 1.1 1.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SAOUHSC_02101&oldid=102329"