From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_001916
  • pan locus tag?: SAUPAN004902000
  • symbol: JSNZ_001916
  • pan gene symbol?: vraU
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_001916
  • symbol: JSNZ_001916
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1930916..1931302
  • length: 387
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAACTATGTTGAACGTTATATTGAACAGTTTTTGAGAGCAACAGTAAGAAATAATATC
    AAGCACTACCTTTTAATGCTAGATGAAAAAATGAAAAATTTAGATGATTATATGCGTTAT
    TTAATTACTAAAAAAGAACAACTTAGCAAGTTAATTGACAGTCTAATGCTAACATTAGAA
    AATAAATATATTGATATTGCTGAAGCATTTCAAATTCAATGTGCAAGAGAAATCAATAAT
    CAAGAAATTGAAAATATTAAATCAGAGTTGAATAAAGTTGAAGCATATTATGCACAAATT
    GAAACTCAAATTCAACAAACTTCAACTGAAAAAATAGCAACAGAAAAAACATCGTATCTA
    ATAAATTATATGAACGCTGTGGCATAG
    60
    120
    180
    240
    300
    360
    387

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_001916
  • symbol: JSNZ_001916
  • description: hypothetical protein
  • length: 128
  • theoretical pI: 4.98573
  • theoretical MW: 15289.5
  • GRAVY: -0.490625

Function[edit | edit source]

  • TIGRFAM:
    two transmembrane protein (TIGR04527; HMM-score: 15.6)
    flagellar export protein FliJ (TIGR02473; HMM-score: 12.9)
    and 1 more
    Genetic information processing Protein fate Protein folding and stabilization prefoldin, alpha subunit (TIGR00293; HMM-score: 11.9)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    no clan defined DUF5660; Domain of unknown function (DUF5660) (PF18904; HMM-score: 19.7)
    and 12 more
    DUF6617; Family of unknown function (DUF6617) (PF20322; HMM-score: 15.2)
    DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 14.9)
    Fusion_gly (CL0595) Baculo_F; Baculovirus F protein (PF12259; HMM-score: 14)
    GADPH_aa-bio_dh (CL0139) DAPDH_C; Diaminopimelic acid dehydrogenase C-terminal domain (PF16654; HMM-score: 13.8)
    no clan defined DUF1978; Domain of unknown function (DUF1978) (PF09321; HMM-score: 13.1)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 12.8)
    no clan defined ApoO; Apolipoprotein O (PF09769; HMM-score: 12.2)
    Med28; Mediator complex subunit 28 (PF11594; HMM-score: 11.5)
    SKA2; Spindle and kinetochore-associated protein 2 (PF16740; HMM-score: 11.3)
    DUF4795; Domain of unknown function (DUF4795) (PF16043; HMM-score: 10.9)
    Mer2; Mer2 (PF09074; HMM-score: 10.7)
    LAMB4; Laminin subunit beta-4-like domain (PF24999; HMM-score: 9.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0.2738
    • Cytoplasmic Membrane Score: 0.0278
    • Cell wall & surface Score: 0.0005
    • Extracellular Score: 0.6979
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000789
    • TAT(Tat/SPI): 0.000078
    • LIPO(Sec/SPII): 0.000162
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MNYVERYIEQFLRATVRNNIKHYLLMLDEKMKNLDDYMRYLITKKEQLSKLIDSLMLTLENKYIDIAEAFQIQCAREINNQEIENIKSELNKVEAYYAQIETQIQQTSTEKIATEKTSYLINYMNAVA

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [2] [3]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  3. Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)