From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_001913
  • pan locus tag?: SAUPAN004899000
  • symbol: vraR
  • pan gene symbol?: vraR
  • synonym:
  • product: two-component system response regulator VraR

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_001913
  • symbol: vraR
  • product: two-component system response regulator VraR
  • replicon: chromosome
  • strand: -
  • coordinates: 1928541..1929170
  • length: 630
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGATTAAAGTATTGTTTGTGGATGATCATGAAATGGTACGTATAGGAATTTCAAGT
    TATCTATCAACGCAAAGTGATATTGAAGTAGTTGGTGAAGGCGCTTCTGGTAAGGAAGCA
    ATTGCCAAAGCCCATGAGTTGAAGCCAGATTTAATTTTAATGGATTTACTTATGGAAGAC
    ATGGATGGTGTAGAAGCGACGACTCAGATTAAAAAAGATTTACCGCAAATTAAAGTATTA
    ATGTTAACTAGTTTTATTGAAGATAAAGAGGTATATCGTGCATTAGATGCAGGTGTCGAT
    AGTTACATTTTAAAAACAACAAGTGCAAAAGATATCGCCGATGCAGTTCGTAAAACTTCT
    ATAGGAGAATCTGTTTTTGAACCGGAAGTTTTAGTGAAAATGCGTAACCGTATGAAAAAG
    CGCGCAGAGTTATATGAAATGCTTACAGAACGAGAAATGGAAATATTATTATTGATTGCG
    AAAGGTTACTCAAATCAAGAAATTGCTAGTGCATCGCATATTACTATTAAAACGGTTAAG
    ACACATGTGAGTAACATTTTAAGTAAGTTAGAAGTGCAAGATAGAACACAAGCTGTCATC
    TATGCATTCCAACATAATTTAATTCAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    630

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_001913
  • symbol: VraR
  • description: two-component system response regulator VraR
  • length: 209
  • theoretical pI: 5.17115
  • theoretical MW: 23516.2
  • GRAVY: -0.0784689

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 71.2)
    and 16 more
    transcriptional regulator EpsA (TIGR03020; HMM-score: 55.8)
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 54.4)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 54.4)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 35.7)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 35.7)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 35.7)
    LuxR family transcriptional regulatory, chaperone HchA-associated (TIGR03541; HMM-score: 34.4)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 33.8)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 26.4)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 24.2)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 21.4)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.3)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.3)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 15.4)
    tRNA-dependent cyclodipeptide synthase (TIGR04539; HMM-score: 13.2)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 12.9)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 93.5)
    and 14 more
    HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 70.7)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 33.5)
    HTH_40; Helix-turn-helix domain (PF14493; HMM-score: 16.5)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 16.4)
    no clan defined DUF3194; Protein of unknown function (DUF3194) (PF11419; HMM-score: 15.9)
    HTH (CL0123) UPF0122; Putative helix-turn-helix protein, YlxM / p13 like (PF04297; HMM-score: 15.7)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15.5)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.2)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 13.6)
    PDDEXK (CL0236) PDDEXK_10; PD-(D/E)XK nuclease superfamily (PF07788; HMM-score: 13.3)
    HTH (CL0123) wHTH-PRTase_assc; wHTH-PRTase associated (PF24409; HMM-score: 13.3)
    no clan defined B12-binding; B12 binding domain (PF02310; HMM-score: 13.1)
    GT-A (CL0110) Rhamno_transf; Putative rhamnosyl transferase (PF11316; HMM-score: 12.8)
    HTH (CL0123) HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 12.8)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9868
    • Cytoplasmic Membrane Score: 0.0019
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0111
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006685
    • TAT(Tat/SPI): 0.000295
    • LIPO(Sec/SPII): 0.000629
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MTIKVLFVDDHEMVRIGISSYLSTQSDIEVVGEGASGKEAIAKAHELKPDLILMDLLMEDMDGVEATTQIKKDLPQIKVLMLTSFIEDKEVYRALDAGVDSYILKTTSAKDIADAVRKTSIGESVFEPEVLVKMRNRMKKRAELYEMLTEREMEILLLIAKGYSNQEIASASHITIKTVKTHVSNILSKLEVQDRTQAVIYAFQHNLIQ

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [3] [4]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Antoaneta Belcheva, Dasantila Golemi-Kotra
    A close-up view of the VraSR two-component system. A mediator of Staphylococcus aureus response to cell wall damage.
    J Biol Chem: 2008, 283(18);12354-64
    [PubMed:18326495] [WorldCat.org] [DOI] (P p)
  2. Pedro B Fernandes, Patricia Reed, João M Monteiro, Mariana G Pinho
    Revisiting the Role of VraTSR in Staphylococcus aureus Response to Cell Wall-Targeting Antibiotics.
    J Bacteriol: 2022, 204(8);e0016222
    [PubMed:35862765] [WorldCat.org] [DOI] (I p)
  3. 3.0 3.1 Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  4. 4.0 4.1 Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)
  5. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]