From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1942 [new locus tag: SACOL_RS10155 ]
  • pan locus tag?: SAUPAN004899000
  • symbol: vraR
  • pan gene symbol?: vraR
  • synonym:
  • product: DNA-binding response regulator VraR

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1942 [new locus tag: SACOL_RS10155 ]
  • symbol: vraR
  • product: DNA-binding response regulator VraR
  • replicon: chromosome
  • strand: -
  • coordinates: 2004941..2005570
  • length: 630
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGATTAAAGTATTGTTTGTGGATGATCATGAAATGGTACGTATAGGAATTTCAAGT
    TATCTATCAACGCAAAGTGATATTGAAGTAGTTGGTGAAGGCGCTTCTGGTAAAGAAGCA
    ATTGCCAAAGCCCATGAGTTGAAGCCAGATTTAATTTTAATGGATTTACTTATGGATGAC
    ATGGATGGTGTAGAAGCGACGACTCAGATTAAAAAAGATTTACCGCAAATTAAAGTATTA
    ATGTTAACTAGTTTTATTGAAGATAAAGAGGTATATCGTGCATTAGATGCAGGTGTCGAT
    AGTTACATTTTAAAAACAACAAGTGCAAAAGATATCGCCGATGCAGTTCGTAAAACTTCT
    AGAGGAGAATCTGTTTTTGAACCGGAAGTTTTAGTGAAAATGCGTAACCGTATGAAAAAG
    CGCGCAGAGTTATATGAAATGCTTACAGAACGAGAAATGGAAATATTATTATTGATTGCG
    AAAGGTTACTCAAATCAAGAAATTGCTAGTGCATCGCATATTACTATTAAAACGGTTAAG
    ACACATGTGAGTAACATTTTAAGTAAGTTAGAAGTGCAAGATAGAACACAAGCTGTTATC
    TATGCATTCCAACATAATTTAATTCAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    630


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL1942 [new locus tag: SACOL_RS10155 ]
  • symbol: VraR
  • description: DNA-binding response regulator VraR
  • length: 209
  • theoretical pI: 5.39084
  • theoretical MW: 23545.2
  • GRAVY: -0.121531

⊟Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 72.3)
    and 15 more
    transcriptional regulator EpsA (TIGR03020; HMM-score: 55.8)
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 36.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    LuxR family transcriptional regulatory, chaperone HchA-associated (TIGR03541; HMM-score: 34)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 26.4)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 25.5)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 21.1)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 15.8)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 13.4)
  • TheSEED  :
    • Two component transcriptional regulator VraR
    CBSS-176280.1.peg.1561  Two component transcriptional regulator VraR
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 93.3)
    and 14 more
    HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 71.1)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 33.6)
    HTH_40; Helix-turn-helix domain (PF14493; HMM-score: 17.9)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 16.6)
    UPF0122; Putative helix-turn-helix protein, YlxM / p13 like (PF04297; HMM-score: 15.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15.5)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.3)
    no clan defined DUF3194; Protein of unknown function (DUF3194) (PF11419; HMM-score: 15)
    PDDEXK (CL0236) PDDEXK_10; PD-(D/E)XK nuclease superfamily (PF07788; HMM-score: 14)
    HTH (CL0123) HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 13.7)
    wHTH-PRTase_assc; wHTH-PRTase associated (PF24409; HMM-score: 13.6)
    no clan defined B12-binding; B12 binding domain (PF02310; HMM-score: 13)
    GT-A (CL0110) Rhamno_transf; Putative rhamnosyl transferase (PF11316; HMM-score: 12.9)
    HTH (CL0123) HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 12.9)

⊟Structure, modifications & cofactors[edit | edit source]

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9867
    • Cytoplasmic Membrane Score: 0.0016
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0116
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006867
    • TAT(Tat/SPI): 0.000297
    • LIPO(Sec/SPII): 0.000634
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MTIKVLFVDDHEMVRIGISSYLSTQSDIEVVGEGASGKEAIAKAHELKPDLILMDLLMDDMDGVEATTQIKKDLPQIKVLMLTSFIEDKEVYRALDAGVDSYILKTTSAKDIADAVRKTSRGESVFEPEVLVKMRNRMKKRAELYEMLTEREMEILLLIAKGYSNQEIASASHITIKTVKTHVSNILSKLEVQDRTQAVIYAFQHNLIQ

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [5] [6] [7]
  • quantitative data / protein copy number per cell: 431 [8]
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [3] [4]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: 136.77 h [9]

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Antoaneta Belcheva, Dasantila Golemi-Kotra
    A close-up view of the VraSR two-component system. A mediator of Staphylococcus aureus response to cell wall damage.
    J Biol Chem: 2008, 283(18);12354-64
    [PubMed:18326495] [WorldCat.org] [DOI] (P p)
  2. ↑ Pedro B Fernandes, Patricia Reed, João M Monteiro, Mariana G Pinho
    Revisiting the Role of VraTSR in Staphylococcus aureus Response to Cell Wall-Targeting Antibiotics.
    J Bacteriol: 2022, 204(8);e0016222
    [PubMed:35862765] [WorldCat.org] [DOI] (I p)
  3. ↑ 3.0 3.1 Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  4. ↑ 4.0 4.1 Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)
  5. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  6. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  7. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  8. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  9. ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

S Gardete, S W Wu, S Gill, A Tomasz
Role of VraSR in antibiotic resistance and antibiotic-induced stress response in Staphylococcus aureus.
Antimicrob Agents Chemother: 2006, 50(10);3424-34
[PubMed:17005825] [WorldCat.org] [DOI] (P p)
Elena Galbusera, Adriana Renzoni, Diego O Andrey, Antoinette Monod, Christine Barras, Paolo Tortora, Alessandra Polissi, William L Kelley
Site-specific mutation of Staphylococcus aureus VraS reveals a crucial role for the VraR-VraS sensor in the emergence of glycopeptide resistance.
Antimicrob Agents Chemother: 2011, 55(3);1008-20
[PubMed:21173175] [WorldCat.org] [DOI] (I p)
Oren Levinger, Tamar Bikels-Goshen, Elad Landau, Merav Fichman, Roni Shapira
Epigallocatechin gallate induces upregulation of the two-component VraSR system by evoking a cell wall stress response in Staphylococcus aureus.
Appl Environ Microbiol: 2012, 78(22);7954-9
[PubMed:22941085] [WorldCat.org] [DOI] (I p)