Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS06155 [old locus tag: SA1086 ]
- pan locus tag?: SAUPAN003535000
- symbol: SA_RS06155
- pan gene symbol?: rbgA
- synonym:
- product: ribosome biogenesis GTPase YlqF
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGGTTATTCAATGGTATCCAGGACATATGGCGAAAGCCAAAAGAGAAGTAAGTGAACAA
TTAAAAAAAGTAGATGTAGTGTTTGAACTAGTAGATGCAAGAATTCCATATAGTTCAAGA
AACCCTATGATAGATGAAGTTATTAACCAAAAACCACGTGTTGTTATATTAAATAAAAAA
GATATGTCTAATTTAAATGAGATGTCAAAATGGGAACAATTTTTTATTGATAAAGGATAC
TATCCTGTATCAGTGGATGCTAAGCACGGTAAAAATTTAAAGAAAGTGGAAGCTGCAGCA
ATTAAGGCGACTGCTGAAAAATTTGAACGCGAAAAAGCGAAAGGACTTAAACCTAGAGCG
ATAAGAGCAATGATCGTTGGAATTCCAAATGTTGGTAAATCCACATTAATAAATAAACTG
GCAAAGCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGG
ATTAAAGTTAGTAATGCATTACAACTATTAGACACACCAGGGATACTTTGGCCTAAATTT
GAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACTGGTGCGATAAAAGATAGTATTGTG
CACTTAGATGAAGTTGCCATCTATGGATTAAACTTTTTAATTCAAAATGATTTAGCGCGA
TTAAAGTCACATTATAATATTGAAGTTCCTGAAGATGCAGAAATCATAGCGTGGTTTGAT
GCGATAGGGAAAAAACGTGGCTTAATTCGACGTGGTAATGAAATTGATTACGAAGCAGTC
ATTGAACTGATTATTTATGATATTCGAAATGCTAAAATAGGAAATTATTGTTTTGATATT
TTTAAAGATATGACTGAGGAATTAGCAAATGACGCTAACAATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
885
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS06155 [old locus tag: SA1086 ]
- symbol: SA_RS06155
- description: ribosome biogenesis GTPase YlqF
- length: 294
- theoretical pI: 9.6036
- theoretical MW: 33410.5
- GRAVY: -0.351701
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 365.3)and 16 moreProtein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 72.1)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 54.6)Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 53.7)Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 49.9)Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 44.4)Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 38.3)Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 34.3)Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 28.5)Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 25.3)Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 23.8)Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 23.6)Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 22)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 13.6)Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 13.1)
- TheSEED: see SA1086
- PFAM: P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 76.8)and 15 moreFeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 42.2)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 33.1)Dynamin_N; Dynamin family (PF00350; HMM-score: 20.6)Arf; ADP-ribosylation factor family (PF00025; HMM-score: 17.7)AAA_18; AAA domain (PF13238; HMM-score: 16.9)GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 15.6)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 14.4)Septin; Septin (PF00735; HMM-score: 14)Ras; Ras family (PF00071; HMM-score: 13.9)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 13.2)TniB; Bacterial TniB protein (PF05621; HMM-score: 12.9)PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 12.8)RNA_helicase; RNA helicase (PF00910; HMM-score: 12.6)AIG1; AIG1 family (PF04548; HMM-score: 12.2)AAA_25; AAA domain (PF13481; HMM-score: 12.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9528
- Cytoplasmic Membrane Score: 0.0086
- Cell wall & surface Score: 0
- Extracellular Score: 0.0386
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002066
- TAT(Tat/SPI): 0.00021
- LIPO(Sec/SPII): 0.000572
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVIQWYPGHMAKAKREVSEQLKKVDVVFELVDARIPYSSRNPMIDEVINQKPRVVILNKKDMSNLNEMSKWEQFFIDKGYYPVSVDAKHGKNLKKVEAAAIKATAEKFEREKAKGLKPRAIRAMIVGIPNVGKSTLINKLAKRSIAQTGNKPGVTKQQQWIKVSNALQLLDTPGILWPKFEDEEVGKKLSLTGAIKDSIVHLDEVAIYGLNFLIQNDLARLKSHYNIEVPEDAEIIAWFDAIGKKRGLIRRGNEIDYEAVIELIIYDIRNAKIGNYCFDIFKDMTEELANDANN
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA_RS11130 (deoA) pyrimidine-nucleoside phosphorylase [2] (data from MRSA252) SA_RS00690 immunoglobulin G-binding protein A [2] (data from MRSA252) SA_RS01275 formate acetyltransferase [2] (data from MRSA252) SA_RS01710 5'-nucleotidase, lipoprotein e(P4) family [2] (data from MRSA252) SA_RS02910 50S ribosomal protein L1 [2] (data from MRSA252) SA_RS02915 50S ribosomal protein L10 [2] (data from MRSA252) SA_RS02920 50S ribosomal protein L7/L12 [2] (data from MRSA252) SA_RS02945 30S ribosomal protein S12 [2] (data from MRSA252) SA_RS02955 elongation factor G [2] (data from MRSA252) SA_RS02960 elongation factor Tu [2] (data from MRSA252) SA_RS04025 preprotein translocase subunit SecA [2] (data from MRSA252) SA_RS04575 NADH dehydrogenase [2] (data from MRSA252) SA_RS05350 pyruvate dehydrogenase E1 component subunit alpha [2] (data from MRSA252) SA_RS05355 pyruvate dehydrogenase E1 component subunit beta [2] (data from MRSA252) SA_RS05360 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [2] (data from MRSA252) SA_RS05365 dihydrolipoyl dehydrogenase [2] (data from MRSA252) SA_RS05860 cell division protein FtsZ [2] (data from MRSA252) SA_RS06140 50S ribosomal protein L19 [2] (data from MRSA252) SA_RS06225 30S ribosomal protein S2 [2] (data from MRSA252) SA_RS07060 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [2] (data from MRSA252) SA_RS07385 DNA-binding protein HU [2] (data from MRSA252) SA_RS07955 molecular chaperone DnaK [2] (data from MRSA252) SA_RS08295 50S ribosomal protein L21 [2] (data from MRSA252) SA_RS08460 50S ribosomal protein L20 [2] (data from MRSA252) SA_RS08545 isocitrate dehydrogenase (NADP(+)) [2] (data from MRSA252) SA_RS08560 pyruvate kinase [2] (data from MRSA252) SA_RS08565 ATP-dependent 6-phosphofructokinase [2] (data from MRSA252) SA_RS08675 30S ribosomal protein S4 [2] (data from MRSA252) SA_RS11430 Asp23/Gls24 family envelope stress response protein [2] (data from MRSA252) SA_RS11600 30S ribosomal protein S9 [2] (data from MRSA252) SA_RS11640 30S ribosomal protein S11 [2] (data from MRSA252) SA_RS11670 50S ribosomal protein L15 [2] (data from MRSA252) SA_RS11680 30S ribosomal protein S5 [2] (data from MRSA252) SA_RS11685 50S ribosomal protein L18 [2] (data from MRSA252) SA_RS11690 50S ribosomal protein L6 [2] (data from MRSA252) SA_RS11705 50S ribosomal protein L5 [2] (data from MRSA252) SA_RS11720 30S ribosomal protein S17 [2] (data from MRSA252) SA_RS11730 50S ribosomal protein L16 [2] (data from MRSA252) SA_RS11735 30S ribosomal protein S3 [2] (data from MRSA252) SA_RS11740 50S ribosomal protein L22 [2] (data from MRSA252) SA_RS11750 50S ribosomal protein L2 [2] (data from MRSA252) SA_RS11755 50S ribosomal protein L23 [2] (data from MRSA252) SA_RS11760 50S ribosomal protein L4 [2] (data from MRSA252) SA_RS11765 50S ribosomal protein L3 [2] (data from MRSA252) SA_RS13735 malate:quinone oxidoreductase [2] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p) - ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)