Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2518 [new locus tag: SACOL_RS13185 ]
- pan locus tag?: SAUPAN006134000
- symbol: SACOL2518
- pan gene symbol?: relP
- synonym: JSNZ_002486
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2518 [new locus tag: SACOL_RS13185 ]
- symbol: SACOL2518
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2577779..2578471
- length: 693
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238293 NCBI
- RefSeq: YP_187312 NCBI
- BioCyc: see SACOL_RS13185
- MicrobesOnline: 913990 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGTATGTAGATCGAAAACCATCACTATATTTAGAGGATTTGCGACATGATTTTAAAAAT
AGTTTAAGTAAATTTGAAAATGGTGATGAAGCATTTGATACGTTATTAGGTTTCGTAGAG
TTAGATCATATTTATTCGTCAGCACTAAAGGAAATAAGCACTAAACTGAGTATTTTAGAT
GACAATTTCAATCACATTTATAAACACAATCCTATACATCATATGGAGCGACGTGTGAAA
GAAATGCGTAGTTTAATAGAAAAGCTTAATCGTAAAGGATTACAGATTAGCGCAGAAACT
GCCAAAGAACATATACTGGATATTGCCGGAATTCGCGTAGTATGTAATTACTTAGATGAT
ATTTATTTGATTGAAGAGATGTTGCTTAAACAAGAAGACGTACAATTGATAAAACGTAAA
GATTATATTCAGCACCCTAAAGAAAATGGTTACCGCAGTTTACATATCGTTGTATCTATT
CCAGTCTTTTTAGCAGAACGCGTTGAGGTATTGCCTGTTGAAATTCAAATTAGAACGATA
GGTATGGATATGTGGGCAAGTTTAGAACATAAAATACGTTATAAAAACAATGCAGAGACG
GAAAAGTATCGAGATTTACTGAAAGAATGTGCGACAGAGATTACTGAAGTTGAAGATAAA
TTACAACAAATTCATTCTGAAATAACAGAGTAG60
120
180
240
300
360
420
480
540
600
660
693
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2518 [new locus tag: SACOL_RS13185 ]
- symbol: SACOL2518
- description: hypothetical protein
- length: 230
- theoretical pI: 5.77612
- theoretical MW: 27165
- GRAVY: -0.47087
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Adaptations to atypical conditions RelA/SpoT family protein (TIGR00691; HMM-score: 59.7)
- TheSEED :
- ((p)p)pGpp synthetase RelP
- PFAM: NTP_transf (CL0260) RelA_SpoT; Region found in RelA / SpoT proteins (PF04607; HMM-score: 120.7)and 5 moreSNARE-fusion (CL0445) V-SNARE; Vesicle transport v-SNARE protein N-terminus (PF05008; HMM-score: 19.1)HRDC-like (CL0426) UvsW-1; UvsW.1 domain (PF11637; HMM-score: 14.3)no clan defined DUF4140; N-terminal domain of unknown function (DUF4140) (PF13600; HMM-score: 13.7)GOLD-like (CL0521) EMP24_GP25L; emp24/gp25L/p24 family/GOLD (PF01105; HMM-score: 13.1)HTH (CL0123) RNase_H2-Ydr279; Ydr279p protein family (RNase H2 complex component) wHTH domain (PF09468; HMM-score: 12.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9787
- Cytoplasmic Membrane Score: 0.0116
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0096
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00153
- TAT(Tat/SPI): 0.000146
- LIPO(Sec/SPII): 0.000279
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYVDRKPSLYLEDLRHDFKNSLSKFENGDEAFDTLLGFVELDHIYSSALKEISTKLSILDDNFNHIYKHNPIHHMERRVKEMRSLIEKLNRKGLQISAETAKEHILDIAGIRVVCNYLDDIYLIEEMLLKQEDVQLIKRKDYIQHPKENGYRSLHIVVSIPVFLAERVEVLPVEIQIRTIGMDMWASLEHKIRYKNNAETEKYRDLLKECATEITEVEDKLQQIHSEITE
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 192 [4]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: VraR/JSNZ_001913 (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
Mol Microbiol: 2003, 49(3);807-21
[PubMed:12864861] [WorldCat.org] [DOI] (P p) - ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Tobias Geiger, Benjamin Kästle, Fabio Lino Gratani, Christiane Goerke, Christiane Wolz
Two small (p)ppGpp synthases in Staphylococcus aureus mediate tolerance against cell envelope stress conditions.
J Bacteriol: 2014, 196(4);894-902
[PubMed:24336937] [WorldCat.org] [DOI] (I p)
