Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2517 [new locus tag: SACOL_RS13180 ]
- pan locus tag?: SAUPAN006133000
- symbol: SACOL2517
- pan gene symbol?: —
- synonym:
- product: MerR family transcriptional regulator
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2517 [new locus tag: SACOL_RS13180 ]
- symbol: SACOL2517
- product: MerR family transcriptional regulator
- replicon: chromosome
- strand: -
- coordinates: 2576850..2577614
- length: 765
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238292 NCBI
- RefSeq: YP_187311 NCBI
- BioCyc: see SACOL_RS13180
- MicrobesOnline: 913989 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGTCTAACTATTCGACTGGAGAACTCGCAAAATTATGCAATGTGACAACACGAACGATT
CAATATTATGATCGCAAAGGTATTTTGAAACCACAAGGATTTACAGAAGGAAAGCGTCGT
GTGTATACAGAACAACAGCGACAAACATTAGAGTTAATCTTATTGCTTAAAGATTTAGGT
TGTGCGTTAAGCGATATAGATATGTTGCTAAAAGGTGAAGGTACTTTGAAGACGCTCAAT
ACTTTACTAACTATGAAACAACAAGAAATTAACCAACAAGTTAAACAGCAACAAGCGGTA
TTAAACAAAATTAAAAATGTTCAATATTACGTAAATGAAGCGTCGACGTCTCCAATCACA
CACTTAAAAGACATAGAGCATGTCATGAGTAAATCAGCTGAAATGAAAAGTATTCGTCGT
AACATTTGGATTAGTGCTGGTATTATAGGAATAATTCAATATTCTAGCATTATAAGTGCA
ATTTTGATGAAAAATAAATGGCCGTTTTTAATTGCTTTACCATTTATGATTGGTTATGGC
ATTGGTGTTACTTTTTATTACCAACAAAAGGTTGCCTATTTATGTCCTAACTGCCAGCAT
ATATTCTCACCATCTTTGTGGGCAGTTATCAAAGCGAAACATACAGCGACAACACGTCGA
TTCGAATGTCCAAACTGTCATGAAACGCATTATTGCATTGAAGTACCTAAAGCGCATATG
AGTACAGAACAATTAGAAATATCCCACATACAACATAACAATTAA60
120
180
240
300
360
420
480
540
600
660
720
765
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2517 [new locus tag: SACOL_RS13180 ]
- symbol: SACOL2517
- description: MerR family transcriptional regulator
- length: 254
- theoretical pI: 9.42155
- theoretical MW: 29141.8
- GRAVY: -0.238189
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions Zn(II)-responsive transcriptional regulator (TIGR02043; HMM-score: 59)and 8 moreCellular processes Detoxification Hg(II)-responsive transcriptional regulator (TIGR02051; HMM-score: 44.9)Regulatory functions DNA interactions Hg(II)-responsive transcriptional regulator (TIGR02051; HMM-score: 44.9)Regulatory functions DNA interactions Cd(II)/Pb(II)-responsive transcriptional regulator (TIGR02047; HMM-score: 44.5)Regulatory functions DNA interactions Cu(I)-responsive transcriptional regulator (TIGR02044; HMM-score: 40.5)Cellular processes Detoxification redox-sensitive transcriptional activator SoxR (TIGR01950; HMM-score: 19.6)Regulatory functions DNA interactions redox-sensitive transcriptional activator SoxR (TIGR01950; HMM-score: 19.6)cxxc_20_cxxc protein (TIGR04104; HMM-score: 16.1)MJ0042 family finger-like domain (TIGR02098; HMM-score: 5.7)
- TheSEED :
- Transcriptional regulator, MerR family
- PFAM: HTH (CL0123) MerR_1; MerR HTH family regulatory protein (PF13411; HMM-score: 61.7)and 25 moreMerR; MerR family regulatory protein (PF00376; HMM-score: 46.7)HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 19.6)MerR-DNA-bind; MerR, DNA binding (PF09278; HMM-score: 18.8)RING (CL0229) C1_4; TFIIH C1-like domain (PF07975; HMM-score: 17)Zn_Beta_Ribbon (CL0167) HVO_2753_ZBP; Small zinc finger protein HVO_2753-like, Zn-binding pocket (PF07754; HMM-score: 16.8)Zn_ribbon_4; zinc-ribbon domain (PF13717; HMM-score: 15.4)Tbcl_zf (CL0839) DUF4379; Probable Treble clef zinc finger domain (PF14311; HMM-score: 14.6)no clan defined RAC_head; Ribosome-associated complex head domain (PF16717; HMM-score: 14.5)Zn_Beta_Ribbon (CL0167) Zn_ribbon_8; Zinc ribbon domain (PF09723; HMM-score: 14)Zn_ribbon_20; Zinc beta-ribbon domain (PF23551; HMM-score: 13.8)C2H2-zf (CL0361) zf-Di19; Drought induced 19 protein (Di19), zinc-binding (PF05605; HMM-score: 12.1)Zn_Beta_Ribbon (CL0167) Cas12f1-like_TNB; Cas12f1-like, TNB domain (PF07282; HMM-score: 11.8)Zn_ribbon_16; Zinc beta-ribbon finger, putative (PF21957; HMM-score: 11.8)Zn_ribbon_10; ER junction formation factor lunapark, zinc ribbon finger (PF10058; HMM-score: 10.9)no clan defined Opy2; Opy2 protein (PF09463; HMM-score: 10.8)Zn_Beta_Ribbon (CL0167) Zn_ribbon_FGT1_1; FORGETTER1 first zinc ribbon domain (PF23547; HMM-score: 10.6)Zn_ribbon_Nudix; Nudix N-terminal (PF14803; HMM-score: 10.3)Zn_ribbon_TFIIS; Transcription factor S-II (TFIIS) (PF01096; HMM-score: 10.2)no clan defined SlyX; SlyX (PF04102; HMM-score: 10.1)Tbcl_zf (CL0839) zf_Rg; Reverse gyrase zinc finger (PF17915; HMM-score: 10.1)no clan defined DUF7385; Family of unknown function (DUF7385) (PF24110; HMM-score: 8.9)C2H2-zf (CL0361) zf-H2C2_2; Zinc-finger double domain (PF13465; HMM-score: 8.5)Zn_Beta_Ribbon (CL0167) DUF7560; Family of unknown function (DUF7560) (PF24441; HMM-score: 8.1)CpXC; CpXC protein (PF14353; HMM-score: 7)no clan defined YnfU; YnfU (PF23499; HMM-score: 6.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 2
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0141
- Cytoplasmic Membrane Score: 0.9533
- Cell wall & surface Score: 0.0041
- Extracellular Score: 0.0284
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004422
- TAT(Tat/SPI): 0.000282
- LIPO(Sec/SPII): 0.000685
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSNYSTGELAKLCNVTTRTIQYYDRKGILKPQGFTEGKRRVYTEQQRQTLELILLLKDLGCALSDIDMLLKGEGTLKTLNTLLTMKQQEINQQVKQQQAVLNKIKNVQYYVNEASTSPITHLKDIEHVMSKSAEMKSIRRNIWISAGIIGIIQYSSIISAILMKNKWPFLIALPFMIGYGIGVTFYYQQKVAYLCPNCQHIFSPSLWAVIKAKHTATTRRFECPNCHETHYCIEVPKAHMSTEQLEISHIQHNN
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: VraR (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
Mol Microbiol: 2003, 49(3);807-21
[PubMed:12864861] [WorldCat.org] [DOI] (P p) - ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Benjamin P Howden, Danielle J Smith, Ashley Mansell, Paul D R Johnson, Peter B Ward, Timothy P Stinear, John K Davies
Different bacterial gene expression patterns and attenuated host immune responses are associated with the evolution of low-level vancomycin resistance during persistent methicillin-resistant Staphylococcus aureus bacteraemia.
BMC Microbiol: 2008, 8;39
[PubMed:18304359] [WorldCat.org] [DOI] (I e)