From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2531 [new locus tag: NWMN_RS14545 ]
  • pan locus tag?: SAUPAN006361000
  • symbol: arcC
  • pan gene symbol?: arcC
  • synonym:
  • product: carbamate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_2531 [new locus tag: NWMN_RS14545 ]
  • symbol: arcC
  • product: carbamate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2784347..2785315
  • length: 969
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGTTTTTTAAAAGGAGCGACAAAAATATGAAAGAGAAAATTGTCATTGCATTAGGCGGT
    AATGCGATACAGACAACAGAAGCAACAGCTGAAGCACAACAAACAGCTATTAGATGTGCG
    ATGCAAAACCTTAAACCTTTATTTGATTCACCAGCGCGTATTGTGATTTCACATGGTAAT
    GGTCCACAAATTGGAAGTTTATTAATCCAACAAGCTAAATCGAACAGTGACACAACGCCG
    GCAATGCCATTGGATACTTGTGGTGCAATGTCACAGGGTATGATAGGCTATTGGTTGGAA
    ACTGAAATCAATCGCATTTTAACTGAAATGAATAGTGATAGAACTGTAGGCACAATCGTT
    ACACGTGTGGAAGTAGATAAAGATGATCCACGATTTGATAACCCAACTAAACCAATTGGT
    CCTTTTTATACGAAAGAAGAAGTTGAAGAATTACAAAAAGAACAGCCAGACTCAGTCTTT
    AAAGAAGATGCAGGACGTGGTTATAGAAAAGTAGTTGCGTCACCACTACCTCAATCTATA
    CTAGAACACCAGTTAATTCGAACTTTAGCAGACGGTAAAAATATTGTCATTGCATGCGGT
    GGTGGCGGTATTCCAGTTATAAAAAAAGAAAATACCTATGAAGGTGTTGAAGCGGTTATA
    GATAAAGATTTTGCTAGTGAGAAATTAGCAACGCTGATTGAAGCAGATACCTTAATGATT
    CTTACGAATGTAGAAAATGTATTTATTAACTTTAATGAACCTAATCAACAACAAATCGAT
    GATATTGATGTAGCAACACTGAAAAAATACGCGGCACAAGGTAAGTTTGTGGAAGGATCG
    ATGTTGCCAAAAATAGAAGCTGCGATACGATTTGTTGAAAGTGGGGAAAACAAAAAAGTT
    ATCATTACCAATTTAGAGCAGGCATACGAAGCTTTGATTGGTAATAAAGGTACACACATT
    CACATGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    969

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_2531 [new locus tag: NWMN_RS14545 ]
  • symbol: ArcC
  • description: carbamate kinase
  • length: 322
  • theoretical pI: 4.8382
  • theoretical MW: 35483.3
  • GRAVY: -0.301242

Function[edit | edit source]

  • reaction:
    EC 2.7.2.2?  ExPASy
    Carbamate kinase ATP + NH3 + CO2 = ADP + carbamoyl phosphate
  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines carbamate kinase (TIGR00746; EC 2.7.2.2; HMM-score: 392.2)
    and 4 more
    Metabolism Amino acid biosynthesis Glutamate family acetylglutamate kinase (TIGR00761; EC 2.7.2.8; HMM-score: 49.7)
    Metabolism Amino acid biosynthesis Glutamate family glutamate 5-kinase (TIGR01027; EC 2.7.2.11; HMM-score: 25.4)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions putative uridylate kinase (TIGR02076; EC 2.7.4.-; HMM-score: 17.4)
    Metabolism Amino acid biosynthesis Glutamate family delta l-pyrroline-5-carboxylate synthetase (TIGR01092; HMM-score: 11.6)
  • TheSEED  :
    • Carbamate kinase (EC 2.7.2.2)
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation  Carbamate kinase (EC 2.7.2.2)
    and 2 more
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Deiminase Pathway  Carbamate kinase (EC 2.7.2.2)
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Polyamine Metabolism  Carbamate kinase (EC 2.7.2.2)
  • PFAM:
    no clan defined AA_kinase; Amino acid kinase family (PF00696; HMM-score: 85.1)
    and 1 more
    P-loop_NTPase (CL0023) SKI; Shikimate kinase (PF01202; HMM-score: 19.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9856
    • Cytoplasmic Membrane Score: 0.0019
    • Cell wall & surface Score: 0.0003
    • Extracellular Score: 0.0122
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.5
    • Signal peptide possibility: 0
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.215117
    • TAT(Tat/SPI): 0.036642
    • LIPO(Sec/SPII): 0.005572
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MFFKRSDKNMKEKIVIALGGNAIQTTEATAEAQQTAIRCAMQNLKPLFDSPARIVISHGNGPQIGSLLIQQAKSNSDTTPAMPLDTCGAMSQGMIGYWLETEINRILTEMNSDRTVGTIVTRVEVDKDDPRFDNPTKPIGPFYTKEEVEELQKEQPDSVFKEDAGRGYRKVVASPLPQSILEHQLIRTLADGKNIVIACGGGGIPVIKKENTYEGVEAVIDKDFASEKLATLIEADTLMILTNVENVFINFNEPNQQQIDDIDVATLKKYAAQGKFVEGSMLPKIEAAIRFVESGENKKVIITNLEQAYEALIGNKGTHIHM

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_1348(ilvA)threonine dehydratase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: Rex* (repression) regulon, ArcR* (activation) regulon, ArgR* (repression) regulon, CcpA regulon
    Rex*(TF)important in Energy metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    ArcR*(TF)important in Arginine degradation; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    ArgR*(TF)important in Arginine biosynthesis, Arginine degradation; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]