From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02098
  • symbol: SAOUHSC_02098
  • product: DNA-binding response regulator VraR
  • replicon: chromosome
  • strand: -
  • coordinates: 1972962..1973591
  • length: 630
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGATTAAAGTATTGTTTGTGGATGATCATGAAATGGTACGTATAGGAATTTCAAGT
    TATCTATCAACGCAAAGTGATATTGAAGTAGTTGGTGAAGGCGCTTCTGGTAAAGAAGCA
    ATTGCCAAAGCCCATGAGTTGAAGCCAGATTTAATTTTAATGGATTTACTTATGGATGAC
    ATGGATGGTGTAGAAGCGACGACTCAGATTAAAAAAGATTTACCGCAAATTAAAGTATTA
    ATGTTAACTAGTTTTATTGAAGATAAAGAGGTATATCGTGCATTAGATGCAGGTGTCGAT
    AGTTACATTTTAAAAACAACAAGTGCAAAAGATATCGCCGATGCAGTTCGTAAAACTTCT
    AGAGGAGAATCTGTTTTTGAACCGGAAGTTTTAGTGAAAATGCGTAACCGTATGAAAAAG
    CGCGCAGAGTTATATGAAATGCTTACAGAACGAGAAATGGAAATATTATTATTGATTGCG
    AAAGGTTACTCAAATCAAGAAATTGCTAGTGCATCGCATATTACTATTAAAACGGTTAAG
    ACACATGTGAGTAACATTTTAAGTAAGTTAGAAGTGCAAGATAGAACACAAGCTGTTATC
    TATGCATTCCAACATAATTTAATTCAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    630

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02098
  • symbol: SAOUHSC_02098
  • description: DNA-binding response regulator VraR
  • length: 209
  • theoretical pI: 5.39084
  • theoretical MW: 23545.2
  • GRAVY: -0.121531

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 72.3)
    and 15 more
    transcriptional regulator EpsA (TIGR03020; HMM-score: 55.8)
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 36.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    LuxR family transcriptional regulatory, chaperone HchA-associated (TIGR03541; HMM-score: 34)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 26.4)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 25.5)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 21.1)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 15.8)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 13.4)
  • TheSEED  :
    • Two component transcriptional regulator VraR
    CBSS-176280.1.peg.1561  Two component transcriptional regulator VraR
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 93.3)
    and 14 more
    HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 71.1)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 33.6)
    HTH_40; Helix-turn-helix domain (PF14493; HMM-score: 17.9)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 16.6)
    UPF0122; Putative helix-turn-helix protein, YlxM / p13 like (PF04297; HMM-score: 15.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15.5)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.3)
    no clan defined DUF3194; Protein of unknown function (DUF3194) (PF11419; HMM-score: 15)
    PDDEXK (CL0236) PDDEXK_10; PD-(D/E)XK nuclease superfamily (PF07788; HMM-score: 14)
    HTH (CL0123) HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 13.7)
    wHTH-PRTase_assc; wHTH-PRTase associated (PF24409; HMM-score: 13.6)
    no clan defined B12-binding; B12 binding domain (PF02310; HMM-score: 13)
    GT-A (CL0110) Rhamno_transf; Putative rhamnosyl transferase (PF11316; HMM-score: 12.9)
    HTH (CL0123) HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 12.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9867
    • Cytoplasmic Membrane Score: 0.0016
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0116
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006867
    • TAT(Tat/SPI): 0.000297
    • LIPO(Sec/SPII): 0.000634
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTIKVLFVDDHEMVRIGISSYLSTQSDIEVVGEGASGKEAIAKAHELKPDLILMDLLMDDMDGVEATTQIKKDLPQIKVLMLTSFIEDKEVYRALDAGVDSYILKTTSAKDIADAVRKTSRGESVFEPEVLVKMRNRMKKRAELYEMLTEREMEILLLIAKGYSNQEIASASHITIKTVKTHVSNILSKLEVQDRTQAVIYAFQHNLIQ

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Jump up to: 3.0 3.1 3.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]