Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS10200 [old locus tag: SAUSA300_1868 ]
- pan locus tag?: SAUPAN004902000
- symbol: SAUSA300_RS10200
- pan gene symbol?: vraU
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS10200 [old locus tag: SAUSA300_1868 ]
- symbol: SAUSA300_RS10200
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2027962..2028348
- length: 387
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (2027962..2028348) NCBI
- BioCyc: SAUSA300_RS10200 BioCyc
- MicrobesOnline: see SAUSA300_1868
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAACTATGTTGAACGTTATATTGAACAGTTTTTGAGAGCAACAGTAAGAAATAATATC
AAGCACTACCTTTTAATGCTAGATGAAAAAATGAAAAATTTAGATGATTATATGCGTTAT
TTAATTACTAAAAAAGAACAACTTAGCAAGTTAATTGACAGTCTAATGCTAACATTAGAA
AATAAATATATTGATATTGCTGAAGCATTTCAAATTCAATGTGCAAGAGAAATCAATAAT
CAAGAAATTGAAAATATTAAATCAGAGTTGAATAAAGTTGAAGCATATTATGCACAAATT
GAAACTCAAATTCAACAAACTTCAACTGAAAAAATAGCAACAGAAAAAACATCGTATCTA
ATAAATTATATGAACGCTGTGGCATAG60
120
180
240
300
360
387
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS10200 [old locus tag: SAUSA300_1868 ]
- symbol: SAUSA300_RS10200
- description: hypothetical protein
- length: 128
- theoretical pI: 4.98573
- theoretical MW: 15289.5
- GRAVY: -0.490625
⊟Function[edit | edit source]
- TIGRFAM: two transmembrane protein (TIGR04527; HMM-score: 15.6)flagellar export protein FliJ (TIGR02473; HMM-score: 12.9)and 1 moreProtein fate Protein folding and stabilization prefoldin, alpha subunit (TIGR00293; HMM-score: 11.9)
- TheSEED: see SAUSA300_1868
- PFAM: no clan defined DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 15.7)Fusion_gly (CL0595) Baculo_F; Baculovirus F protein (PF12259; HMM-score: 14.4)no clan defined DUF1978; Domain of unknown function (DUF1978) (PF09321; HMM-score: 14.2)DAPDH_C; Diaminopimelic acid dehydrogenase C-terminal domain (PF16654; HMM-score: 13.9)DUF4795; Domain of unknown function (DUF4795) (PF16043; HMM-score: 13.7)and 6 moreFliD_C; Flagellar hook-associated protein 2 C-terminus (PF07195; HMM-score: 12.3)tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 12.2)no clan defined ApoO; Apolipoprotein O (PF09769; HMM-score: 11.5)Mer2; Mer2 (PF09074; HMM-score: 10.8)SKA2; Spindle and kinetochore-associated protein 2 (PF16740; HMM-score: 10.3)GAG-polyprotein (CL0523) Retrotrans_gag; Retrotransposon gag protein (PF03732; HMM-score: 9.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.000789
- TAT(Tat/SPI): 0.000078
- LIPO(Sec/SPII): 0.000162
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI: 447032923 NCBI
- RefSeq: WP_001110179 NCBI
- UniProt: see SAUSA300_1868
⊟Protein sequence[edit | edit source]
- MNYVERYIEQFLRATVRNNIKHYLLMLDEKMKNLDDYMRYLITKKEQLSKLIDSLMLTLENKYIDIAEAFQIQCAREINNQEIENIKSELNKVEAYYAQIETQIQQTSTEKIATEKTSYLINYMNAVA
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.