Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_02358
- pan locus tag?: SAUPAN005408000
- symbol: SAOUHSC_02358
- pan gene symbol?: prmC
- synonym:
- product: HemK family modification methylase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_02358
- symbol: SAOUHSC_02358
- product: HemK family modification methylase
- replicon: chromosome
- strand: -
- coordinates: 2179756..2180508
- length: 753
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919401 NCBI
- RefSeq: YP_500834 NCBI
- BioCyc: G1I0R-2227 BioCyc
- MicrobesOnline: 1290795 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGTTAGATGTATTTCAATGGACGCGTACGGACTTTGTAGTCCACATGCATGATGATATG
CCGAAAGCGATGATTATGAAGTTCGACTTAGCATTACAACGTATGTTATTAGGAGAGCCT
ATACAGTATATAGTTGGCTTTGCCTCATTTTATGGTAGAACGTTTGATGTAAACTCAAAT
TGTTTGATACCAAGACCTGAAACTGAAGAAGTAATGTTGCATTTCTTACAACAGTTAGAA
GATGATGCAACAATCGTAGATATCGGAACGGGTAGTGGTGTACTTGCAATTACTTTGAAA
TGTGAAAAGCCGGATTTAAATGTTATTGCTACTGATATTTCACTTGAAGCAATGAATATG
GCTCGTAATAATGCTGAGAAGCATCAATCACAAATACAATTTTTAACAGGGGATGCATTA
AAGCCCTTAATTAATGAAGGTATCAAGTTGAACGGCTTGATATCTAATCCACCATATATA
GATGAAAAAGATATGGTTACGATGTCTCCAACGGTTACGAGATTCGAACCACATCAGGCA
TTGTTTGCAGATAACCATGGATATGCTATTTATGAATCAATCATTGAAGATTTACCTCAC
GTTATGGAAAAAGGCAGCCCAGTTGTTTTTGAAATTGGTTACAATCAAGGTGAGGCACTT
AAATCAATAATTTTAAATAAATTTCCTGACAAAAAAATCGACATTATTAAAGATATAAAT
GGCCACGATCGAATCGTCTCATTTAAATGGTAA60
120
180
240
300
360
420
480
540
600
660
720
753
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_02358
- symbol: SAOUHSC_02358
- description: HemK family modification methylase
- length: 250
- theoretical pI: 4.69126
- theoretical MW: 28341.5
- GRAVY: -0.1072
⊟Function[edit | edit source]
- reaction: EC 2.1.1.297? ExPASyPeptide chain release factor N5-glutamine methyltransferase S-adenosyl-L-methionine + [peptide chain release factor 1 or 2]-L-glutamine = S-adenosyl-L-homocysteine + [peptide chain release factor 1 or 2]-N5-methyl-L-glutamine
- TIGRFAM: Protein fate Protein modification and repair protein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 253.6)and 21 moreProtein fate Protein modification and repair methyltransferase, HemK family (TIGR00536; HMM-score: 201)Protein synthesis Ribosomal proteins: synthesis and modification protein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific (TIGR03533; EC 2.1.1.-; HMM-score: 114.9)Protein synthesis Ribosomal proteins: synthesis and modification putative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 71.9)Unknown function Enzymes of unknown specificity putative methylase (TIGR00537; HMM-score: 47.7)Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 33.1)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 30.6)Biosynthesis of cofactors, prosthetic groups, and carriers Biotin malonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 29)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 27.6)Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein L11 methyltransferase (TIGR00406; EC 2.1.1.-; HMM-score: 27)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 23.7)Protein synthesis tRNA and rRNA base modification ribosomal RNA small subunit methyltransferase A (TIGR00755; EC 2.1.1.182; HMM-score: 23.3)Protein synthesis tRNA and rRNA base modification tRNA (guanine-N(7)-)-methyltransferase (TIGR00091; EC 2.1.1.33; HMM-score: 21)Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 18.9)Protein fate Protein modification and repair protein-L-isoaspartate O-methyltransferase (TIGR00080; EC 2.1.1.77; HMM-score: 15.4)Transcription RNA processing 3' terminal RNA ribose 2'-O-methyltransferase Hen1 (TIGR04074; EC 2.1.1.-; HMM-score: 14.1)Protein synthesis tRNA and rRNA base modification 3' terminal RNA ribose 2'-O-methyltransferase Hen1 (TIGR04074; EC 2.1.1.-; HMM-score: 14.1)Protein synthesis tRNA and rRNA base modification 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG (TIGR00138; EC 2.1.1.170; HMM-score: 14)2-ketoarginine methyltransferase (TIGR04543; EC 2.1.1.243; HMM-score: 13.4)Protein synthesis tRNA and rRNA base modification N2,N2-dimethylguanosine tRNA methyltransferase (TIGR00308; EC 2.1.1.-; HMM-score: 12.3)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides putative sugar O-methyltransferase (TIGR04371; EC 2.1.1.-; HMM-score: 11.9)Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumB (TIGR02085; EC 2.1.1.189; HMM-score: 11.1)
- TheSEED :
- Protein-N(5)-glutamine methyltransferase PrmC, methylates polypeptide chain release factors RF1 and RF2
- PFAM: NADP_Rossmann (CL0063) MTS; Methyltransferase small domain (PF05175; HMM-score: 56.5)and 21 moreno clan defined PrmC_N; PrmC N-terminal domain (PF17827; HMM-score: 41.1)NADP_Rossmann (CL0063) Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 35.1)Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 32.2)PrmA; Ribosomal protein L11 methyltransferase (PrmA) (PF06325; HMM-score: 31.7)Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 28.6)PCMT; Protein-L-isoaspartate(D-aspartate) O-methyltransferase (PCMT) (PF01135; HMM-score: 26.2)Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 24.9)Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 24.4)Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 23.4)Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 21)Methyltransf_2; O-methyltransferase domain (PF00891; HMM-score: 19.8)Methyltransf_16; Lysine methyltransferase (PF10294; HMM-score: 19.3)NpmA; 16S rRNA (adenine(1408)-N(1))-methyltransferase (PF24675; HMM-score: 18.1)GidB; rRNA small subunit methyltransferase G (PF02527; HMM-score: 17.8)Methyltransf_15; RNA cap guanine-N2 methyltransferase (PF09445; HMM-score: 17.1)TrmK; tRNA (adenine(22)-N(1))-methyltransferase (PF04816; HMM-score: 16.8)Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 16.8)RMNT_CmcI; Rhamnosyl O-methyltransferase/CmcI (PF04989; HMM-score: 15.7)Cons_hypoth95; Conserved hypothetical protein 95 (PF03602; HMM-score: 15.3)UPF0020; RMKL-like, methyltransferase domain (PF01170; HMM-score: 14.3)CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 12.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9976
- Cytoplasmic Membrane Score: 0.0007
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0017
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.001482
- TAT(Tat/SPI): 0.000211
- LIPO(Sec/SPII): 0.000177
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLDVFQWTRTDFVVHMHDDMPKAMIMKFDLALQRMLLGEPIQYIVGFASFYGRTFDVNSNCLIPRPETEEVMLHFLQQLEDDATIVDIGTGSGVLAITLKCEKPDLNVIATDISLEAMNMARNNAEKHQSQIQFLTGDALKPLINEGIKLNGLISNPPYIDEKDMVTMSPTVTRFEPHQALFADNHGYAIYESIIEDLPHVMEKGSPVVFEIGYNQGEALKSIILNKFPDKKIDIIKDINGHDRIVSFKW
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SAOUHSC_02356 < SAOUHSC_02357 < SAOUHSC_02358 < prfA < SAOUHSC_02360predicted SigA promoter [3] : atpC < SAOUHSC_02341 < SAOUHSC_02343 < SAOUHSC_02345 < SAOUHSC_02346 < SAOUHSC_02347 < S904 < SAOUHSC_02349 < SAOUHSC_02350 < SAOUHSC_02351 < SAOUHSC_02352 < upp < glyA < SAOUHSC_02355 < S905 < SAOUHSC_02356 < SAOUHSC_02357 < SAOUHSC_02358 < S906 < prfA < SAOUHSC_02360
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [3]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
