Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_01657
- pan locus tag?: SAUPAN004137000
- symbol: SAOUHSC_01657
- pan gene symbol?: znuC
- synonym:
- product: ABC transporter
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_01657
- symbol: SAOUHSC_01657
- product: ABC transporter
- replicon: chromosome
- strand: -
- coordinates: 1569316..1570101
- length: 786
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3920108 NCBI
- RefSeq: YP_500168 NCBI
- BioCyc: G1I0R-1540 BioCyc
- MicrobesOnline: 1290082 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781ATGCGAGGTGAGAATACGATGACACCAGTCTTTGAATTGAAAAATGTCAATTACTACTAT
GATCATAAAAAAGTGTTAGAAAATATAAACATTAAAATAAATAAAGGTGAATTTTTAGCA
ATTGTTGGACCAAATGGTGCTGGTAAATCAACATTATTGAAGTTGATTCTAGGGTTATTA
CCTTTACAAAGTGGTGAGATTTTTGTTGAAGGTATTGATTTTAAAAATAAGAAAACATCA
ATTAAATTAAGCTATGTATCACAAAAAGCAAATGCCTTTAATTCAGGTTTCCCAGCAAGT
GTTAAAGAAGTTGTTTTAAGCGGATTAACAAAGACAAAACGTCTTTTCCAAACATTTAAT
AGCAAAGATAATGAAAAAGTGATTAAAGTACTAGAAAGACTGAATATAAGTGATTTAATT
CATAAAAATATAGCAGAATTATCAGGTGGTCAACAACAACGTGTAATGATTGCTCGAGCA
TTGATTTCAGAACCTGCAGTATTAGTACTTGATGAACCAACGAATGGTATTGATGCAAAA
CATGTAAGTGAATTTTATAATACTTTAGATCAATTAAAACAAGAAGGTATCACCATTATC
TTAGTTACTCATGATATCGGTGTTGTAGCAGATACTGCTACTGAAGTAGCATGTTTAAAT
AAGCATTTGCATTTCCATGGTACAACTGATGAGTTTAAATCACTTGATGAAGTTGAAATT
TCAAAAATTTATGGACATCCTGTACGTTTTGTCGATCATCAGCATAATCGAGAATGTTGT
AATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
786
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_01657
- symbol: SAOUHSC_01657
- description: ABC transporter
- length: 261
- theoretical pI: 7.71433
- theoretical MW: 29171.3
- GRAVY: -0.2
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 157.1)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 154.2)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 146.2)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 143)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 141.5)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 139.1)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 138.7)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 138.2)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 134.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 134.7)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 131.7)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 131.1)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 131.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 129.6)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 128.9)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 127.7)and 67 moreTransport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 124.9)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 123.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 123.4)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 123.4)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 121.7)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 120.4)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 120.2)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 119.4)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 116.8)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 115.3)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 114.8)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 114.8)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 114.4)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 112.4)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 112)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 111.9)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 111.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 110.6)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 110.6)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 110.1)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 109.3)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 108.3)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 108.1)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 105.2)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 103.8)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 103.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 102.8)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 102.6)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 99.7)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 97.9)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 97.3)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 97.3)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 97)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 96.9)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 96)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 95.1)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 95.1)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 94.5)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 94.4)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 88.8)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 88.8)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 88.8)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 84.7)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 76.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 75.6)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 74.7)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 74.7)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 71.5)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 65.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 64.6)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 59)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 56.8)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 55.9)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 51.7)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 47.8)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 14.9)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 14.1)Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 14)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 13.8)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 13.6)Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 13.6)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 13.6)Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 13.1)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 13.1)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 12.3)DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 11.8)helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 11.5)
- TheSEED :
- Zinc ABC transporter, ATP-binding protein ZnuC
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 127.5)and 30 moreAAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 54.6)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 37.6)AAA_22; AAA domain (PF13401; HMM-score: 32.5)AAA_23; AAA domain (PF13476; HMM-score: 24.5)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 23.2)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 20.5)Zot; Zonular occludens toxin (Zot) (PF05707; HMM-score: 19.5)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 19)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 18.9)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 18.8)ABC_ATPase; P-loop domain (PF09818; HMM-score: 18)NB-ARC; NB-ARC domain (PF00931; HMM-score: 17.4)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 17.3)AAA_15; AAA ATPase domain (PF13175; HMM-score: 17.3)AAA_25; AAA domain (PF13481; HMM-score: 17.2)AAA_14; AAA domain (PF13173; HMM-score: 15.7)AAA_27; AAA domain (PF13514; HMM-score: 15.7)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 15.6)NACHT; NACHT domain (PF05729; HMM-score: 14.8)NADP_Rossmann (CL0063) RS_preATP-grasp-like; Ribonucleotide synthetase preATP-grasp domain (PF22660; HMM-score: 14.7)P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.5)DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 14.3)UBA (CL0214) UBA_3; Fungal ubiquitin-associated domain (PF09288; HMM-score: 13.7)P-loop_NTPase (CL0023) AAA_30; AAA domain (PF13604; HMM-score: 13.4)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 13.1)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 12.9)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 12.9)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.8)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12.1)HAD (CL0137) Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 11.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.2086
- Cytoplasmic Membrane Score: 0.7577
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0332
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.011018
- TAT(Tat/SPI): 0.000236
- LIPO(Sec/SPII): 0.000738
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MRGENTMTPVFELKNVNYYYDHKKVLENINIKINKGEFLAIVGPNGAGKSTLLKLILGLLPLQSGEIFVEGIDFKNKKTSIKLSYVSQKANAFNSGFPASVKEVVLSGLTKTKRLFQTFNSKDNEKVIKVLERLNISDLIHKNIAELSGGQQQRVMIARALISEPAVLVLDEPTNGIDAKHVSEFYNTLDQLKQEGITIILVTHDIGVVADTATEVACLNKHLHFHGTTDEFKSLDEVEISKIYGHPVRFVDHQHNRECCN
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SAOUHSC_02494 (rpsE) 30S ribosomal protein S5 [3] (data from MRSA252) SAOUHSC_00530 elongation factor Tu [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SAOUHSC_01655 < SAOUHSC_01656 < SAOUHSC_01657 < SAOUHSC_01658 < SAOUHSC_01659predicted SigA promoter [4] : SAOUHSC_01655 < SAOUHSC_01656 < SAOUHSC_01657 < S654 < SAOUHSC_01658 < SAOUHSC_01659predicted SigA promoter [4] : SAOUHSC_01655 < SAOUHSC_01656 < SAOUHSC_01657 < S654 < SAOUHSC_01658 < SAOUHSC_01659 < S655 < SAOUHSC_01660 < SAOUHSC_01661 < SAOUHSC_01662 < S656 < SAOUHSC_01663
⊟Regulation[edit | edit source]
- regulator: Zur* (repression) regulon
Zur* (TF) important in Zinc homeostasis; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [4]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.0 3.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ 4.0 4.1 4.2 4.3 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
