From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01492
  • pan locus tag?: SAUPAN003936000
  • symbol: engA
  • pan gene symbol?: engA
  • synonym:
  • product: GTP-binding protein EngA

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01492
  • symbol: engA
  • product: GTP-binding protein EngA
  • replicon: chromosome
  • strand: -
  • coordinates: 1447062..1448372
  • length: 1311
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTAAACCTATAGTAGCTATTGTAGGTAGGCCTAATGTAGGTAAATCTACAATTTTT
    AATAGAATAGTTGGAGAACGTGTTTCGATTGTGGAAGACACGCCAGGTGTAACACGAGAT
    CGTATTTATTCTTCAGGTGAATGGTTAACACATGATTTCAATATTATTGATACAGGTGGT
    ATTGAAATTGGTGATGCACCATTCCAAACACAAATTAGAGCGCAGGCAGAAATCGCCATA
    GATGAAGCGGATGTTATTATTTTTATGGTTAACGTGCGTGAAGGATTGACACAAAGCGAT
    GAAATGGTCGCTCAAATTTTATACAAATCTAAAAAACCGGTCGTATTAGCGGTTAACAAA
    GTAGATAATATGGAAATGCGTACAGACGTGTATGATTTCTATTCATTAGGATTTGGTGAA
    CCGTATCCGATATCAGGGTCACATGGTTTAGGTCTTGGTGACTTGTTAGATGCAGTTGTT
    TCTCATTTTGGTGAAGAGGAAGAAGATCCTTATGATGAAGATACAATTCGACTATCCATT
    ATTGGACGACCAAACGTAGGTAAATCAAGTTTAGTAAATGCTATTTTAGGTGAAGATCGC
    GTTATCGTTTCTAATGTTGCAGGGACAACGAGAGACGCTATTGATACAGAGTATAGTTAT
    GATGGACAAGATTATGTTTTAATCGATACTGCTGGTATGCGTAAAAAAGGAAAAGTATAT
    GAATCAACTGAGAAATATTCAGTATTAAGAGCTTTAAAAGCGATTGAACGTTCAAATGTT
    GTTTTAGTGGTCATAGATGCAGAACAAGGCATCATTGAACAAGATAAACGTGTTGCAGGA
    TATGCACATGAACAAGGTAAAGCAGTCGTGATTGTCGTAAATAAATGGGATACTGTGGAA
    AAAGATAGTAAAACGATGAAGAAATTTGAAGATGAAGTACGTAAAGAATTCCAATTTTTA
    GATTATGCACAAATTGCTTTTGTGTCTGCTAAAGAACGCACAAGATTACGTACATTATTC
    CCTTACATCAATGAAGCAAGTGAAAACCATAAAAAACGTGTTCAAAGTTCAACTTTAAAT
    GAAGTTGTTACTGATGCAATTTCCATGAACCCTACACCAACAGACAAAGGTAGACGTTTG
    AATGTCTTTTATGCAACACAAGTTGCTATAGAACCACCGACATTTGTTGTATTTGTTAAT
    GATGTAGAATTAATGCATTTTTCTTATAAACGCTATTTAGAGAATCAAATCCGTGCCGCT
    TTTGGTTTTGAAGGTACACCAATTCATATTATAGCTCGAAAGAGAAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1311

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01492
  • symbol: EngA
  • description: GTP-binding protein EngA
  • length: 436
  • theoretical pI: 5.0013
  • theoretical MW: 48979.2
  • GRAVY: -0.271789

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 605.2)
    and 29 more
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 181.9)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 175.3)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 167.4)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 153.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 109.7)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 100.6)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 92.3)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 66.2)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 61.2)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 43.9)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 39.3)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 37.4)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines GTP-binding protein (TIGR00991; HMM-score: 36.2)
    Cellular processes Cellular processes Adaptations to atypical conditions GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 33.6)
    Genetic information processing Protein synthesis Translation factors GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 33.6)
    Signal transduction Regulatory functions Other GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 33.6)
    Genetic information processing Protein synthesis Translation factors translation initiation factor IF-2 (TIGR00487; HMM-score: 32.9)
    Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 27.5)
    Unknown function General elongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 26)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 24.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines chloroplast protein import component Toc86/159, G and M domains (TIGR00993; HMM-score: 23.6)
    Genetic information processing Protein synthesis Translation factors translation initiation factor aIF-2 (TIGR00491; HMM-score: 18.7)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 18.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 17)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 12.9)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 12.9)
    Genetic information processing Protein fate Protein modification and repair hydrogenase accessory protein HypB (TIGR00073; HMM-score: 12.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 11.4)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 11)
  • TheSEED  :
    • GTP-binding protein EngA
    Protein Metabolism Protein biosynthesis Universal GTPases  GTP-binding protein EngA
  • PFAM:
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 201.6)
    and 34 more
    no clan defined KH_dom-like; KH-domain-like of EngA bacterial GTPase enzymes, C-terminal (PF14714; HMM-score: 117.2)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 103.7)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 88.1)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 56.6)
    AIG1; AIG1 family (PF04548; HMM-score: 54.8)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 40.5)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 36.5)
    Ras; Ras family (PF00071; HMM-score: 32.2)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 25.1)
    ABC_tran; ABC transporter (PF00005; HMM-score: 24.4)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 22.5)
    Nribosyltransf (CL0498) Nuc_deoxyri_tr2; Nucleoside 2-deoxyribosyltransferase like (PF15891; HMM-score: 21.9)
    P-loop_NTPase (CL0023) RNA_helicase; RNA helicase (PF00910; HMM-score: 21.8)
    AAA_22; AAA domain (PF13401; HMM-score: 19.6)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 19.4)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.6)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 18.4)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 18.4)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 18)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 17.8)
    Nribosyltransf (CL0498) Nuc_deoxyrib_tr; Nucleoside 2-deoxyribosyltransferase (PF05014; HMM-score: 16.9)
    P-loop_NTPase (CL0023) nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 16.2)
    NTPase_1; NTPase (PF03266; HMM-score: 15.9)
    DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 14.8)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 14.4)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 14.4)
    AAA_18; AAA domain (PF13238; HMM-score: 14.4)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 14.3)
    AAA_23; AAA domain (PF13476; HMM-score: 13.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.5)
    Succ_CoA_synth (CL0506) Ligase_CoA; CoA-ligase (PF00549; HMM-score: 12.8)
    HAD (CL0137) PNK3P; Polynucleotide kinase 3 phosphatase (PF08645; HMM-score: 12.6)
    P-loop_NTPase (CL0023) AAA_14; AAA domain (PF13173; HMM-score: 11.9)
    TIM_barrel (CL0036) 4HFCP_synth; 4-HFC-P synthase (PF04476; HMM-score: 10.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9894
    • Cytoplasmic Membrane Score: 0.0053
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0053
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004999
    • TAT(Tat/SPI): 0.000234
    • LIPO(Sec/SPII): 0.000583
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTKPIVAIVGRPNVGKSTIFNRIVGERVSIVEDTPGVTRDRIYSSGEWLTHDFNIIDTGGIEIGDAPFQTQIRAQAEIAIDEADVIIFMVNVREGLTQSDEMVAQILYKSKKPVVLAVNKVDNMEMRTDVYDFYSLGFGEPYPISGSHGLGLGDLLDAVVSHFGEEEEDPYDEDTIRLSIIGRPNVGKSSLVNAILGEDRVIVSNVAGTTRDAIDTEYSYDGQDYVLIDTAGMRKKGKVYESTEKYSVLRALKAIERSNVVLVVIDAEQGIIEQDKRVAGYAHEQGKAVVIVVNKWDTVEKDSKTMKKFEDEVRKEFQFLDYAQIAFVSAKERTRLRTLFPYINEASENHKKRVQSSTLNEVVTDAISMNPTPTDKGRRLNVFYATQVAIEPPTFVVFVNDVELMHFSYKRYLENQIRAAFGFEGTPIHIIARKRN

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [2] [3]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SAOUHSC_01232(rpsB)30S ribosomal protein S2  [4] (data from MRSA252)
    SAOUHSC_02494(rpsE)30S ribosomal protein S5  [4] (data from MRSA252)
    SAOUHSC_00530elongation factor Tu  [4] (data from MRSA252)
    SAOUHSC_00679hypothetical protein  [4] (data from MRSA252)
    SAOUHSC_01041pyruvate dehydrogenase complex, E1 component subunit beta  [4] (data from MRSA252)
    SAOUHSC_01042branched-chain alpha-keto acid dehydrogenase subunit E2  [4] (data from MRSA252)
    SAOUHSC_01043dihydrolipoamide dehydrogenase  [4] (data from MRSA252)
    SAOUHSC_01806pyruvate kinase  [4] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. 4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  5. 5.0 5.1 5.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]