From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01082
  • pan locus tag?: SAUPAN003360000
  • symbol: SAOUHSC_01082
  • pan gene symbol?: isdC
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01082
  • symbol: SAOUHSC_01082
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1045629..1046312
  • length: 684
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    TTGAAAAATATTTTAAAAGTTTTTAATACAACGATTTTAGCGTTAATTATCATCATCGCG
    ACATTCAGTAATTCTGCAAATGCCGCAGATAGCGGTACTTTGAATTATGAGGTTTACAAA
    TACAATACCAATGACACGTCAATTGCTAATGACTATTTTAATAAACCGGCAAAGTACATT
    AAGAAAAATGGTAAATTGTATGTTCAAATAACTGTCAACCACAGTCATTGGATTACTGGA
    ATGAGTATCGAAGGACATAAAGAAAATATTATTAGTAAAAACACTGCCAAAGATGAACGC
    ACTTCTGAATTTGAAGTAAGTAAGTTGAACGGTAAAATAGATGGAAAAATTGACGTTTAT
    ATCGATGAAAAAGTAAATGGAAAGCCATTCAAATATGACCATCATTACAACATTACATAT
    AAATTTAATGGACCAACTGATGTAGCAGGTGCTAATGCACCAGGTAAAGATGATAAAAAT
    TCTGCTTCAGGTAGTGACAAAGGATCTGATGGAACGACTACTGGTCAAAGTGAATCTAAT
    AGTTCGAATAAAGACAAAGTAGAAAATCCACAAACAAATGCTGGTACACCTGCATATATA
    TATGCAATACCAGTTGCATCCTTAGCATTATTAATCGCAATCACATTGTTTGTTAGAAAA
    AAATCTAAAGGCAATGTGGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    684

⊟Protein[edit | edit source]

Protein Data Bank: 2O6P

⊟General[edit | edit source]

  • locus tag: SAOUHSC_01082
  • symbol: SAOUHSC_01082
  • description: hypothetical protein
  • length: 227
  • theoretical pI: 9.42324
  • theoretical MW: 24854.6
  • GRAVY: -0.564317

⊟Function[edit | edit source]

  • TIGRFAM:
    heme uptake protein IsdC (TIGR03656; HMM-score: 320.3)
    and 2 more
    sortase B signal domain, NPQTN class (TIGR03068; HMM-score: 87.3)
    heme uptake protein IsdB (TIGR03657; HMM-score: 14.1)
  • TheSEED  :
    • NPQTN cell wall anchored protein IsdC
    Iron acquisition and metabolism Iron acquisition and metabolism - no subcategory Heme, hemin uptake and utilization systems in GramPositives  NPQTN cell wall anchored protein IsdC
  • PFAM:
    no clan defined NEAT; Iron Transport-associated domain (PF05031; HMM-score: 88.8)
    and 2 more
    FBD (CL0289) SoxG; Sarcosine oxidase, gamma subunit family (PF04268; HMM-score: 12.4)
    no clan defined SKG6; Transmembrane alpha-helix domain (PF08693; HMM-score: 10.7)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 2
  • LocateP: LPxTG Cell-wall anchored
    • Prediction by SwissProt Classification: Cell Wall
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0
    • Signal peptide possibility: 1
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: found LPxTG motif :NPQTN
  • SignalP: Signal peptide SP(Sec/SPI) length 28 aa
    • SP(Sec/SPI): 0.998468
    • TAT(Tat/SPI): 0.000645
    • LIPO(Sec/SPII): 0.000521
    • Cleavage Site: CS pos: 28-29. ANA-AD. Pr: 0.9892
  • predicted transmembrane helices (TMHMM): 2

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKNILKVFNTTILALIIIIATFSNSANAADSGTLNYEVYKYNTNDTSIANDYFNKPAKYIKKNGKLYVQITVNHSHWITGMSIEGHKENIISKNTAKDERTSEFEVSKLNGKIDGKIDVYIDEKVNGKPFKYDHHYNITYKFNGPTDVAGANAPGKDDKNSASGSDKGSDGTTTGQSESNSSNKDKVENPQTNAGTPAYIYAIPVASLALLIAITLFVRKKSKGNVE

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: Fur* (repression) regulon
    Fur*(TF)important in Iron homeostasis; RegPrecise 

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
  4. ↑ Michelle L Reniere, Eric P Skaar
    Staphylococcus aureus haem oxygenases are differentially regulated by iron and haem.
    Mol Microbiol: 2008, 69(5);1304-15
    [PubMed:18643935] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Sarkis K Mazmanian, Hung Ton-That, Kenneth Su, Olaf Schneewind
An iron-regulated sortase anchors a class of surface protein during Staphylococcus aureus pathogenesis.
Proc Natl Acad Sci U S A: 2002, 99(4);2293-8
[PubMed:11830639] [WorldCat.org] [DOI] (P p)John M Taylor, David E Heinrichs
Transferrin binding in Staphylococcus aureus: involvement of a cell wall-anchored protein.
Mol Microbiol: 2002, 43(6);1603-14
[PubMed:11952908] [WorldCat.org] [DOI] (P p)John Mack, Christie Vermeiren, David E Heinrichs, Martin J Stillman
In vivo heme scavenging by Staphylococcus aureus IsdC and IsdE proteins.
Biochem Biophys Res Commun: 2004, 320(3);781-8
[PubMed:15240116] [WorldCat.org] [DOI] (P p)Luciano A Marraffini, Olaf Schneewind
Anchor structure of staphylococcal surface proteins. V. Anchor structure of the sortase B substrate IsdC.
J Biol Chem: 2005, 280(16);16263-71
[PubMed:15718231] [WorldCat.org] [DOI] (P p)Katherine H Sharp, Sabine Schneider, Alan Cockayne, Max Paoli
Crystal structure of the heme-IsdC complex, the central conduit of the Isd iron/heme uptake system in Staphylococcus aureus.
J Biol Chem: 2007, 282(14);10625-31
[PubMed:17287214] [WorldCat.org] [DOI] (P p)Mark Pluym, Naomi Muryoi, David E Heinrichs, Martin J Stillman
Heme binding in the NEAT domains of IsdA and IsdC of Staphylococcus aureus.
J Inorg Biochem: 2008, 102(3);480-8
[PubMed:18194816] [WorldCat.org] [DOI] (P p)

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SAOUHSC_01082&oldid=80242"