From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0757 [new locus tag: SACOL_RS03890 ]
  • pan locus tag?: SAUPAN002582000
  • symbol: SACOL0757
  • pan gene symbol?: fruR
  • synonym:
  • product: DeoR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0757 [new locus tag: SACOL_RS03890 ]
  • symbol: SACOL0757
  • product: DeoR family transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 778780..779544
  • length: 765
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGATGATAATTACTGAAAAAAGACACGAGTTAATATTAGAAGAACTTTTGCACAAAGAT
    TTTTTGACTTTACAAGAATTAATAGATCGAACTGGTTGCAGTGCTTCAACAATACGAAGA
    GATTTATCTAAACTACAACAATTAGGGAAATTGCAACGTGTGCATGGTGGTGCAATGTTA
    AAAGAAAATCGTATGGTTGAGGCGAATTTAACTGAAAAATTAGCAACGAATCTTGATGAA
    AAGAAAATGATTGCTAAAATAGCAGCTAATCAAATCAACGATAATGAATGCTTATTTATC
    GATGCTGGTTCATCTACATTGGAGCTAATTAAATATATTCAAGCGAAAGATATCATTGTG
    GTAACCAATGGTTTAACACATGTAGAAGCTTTACTTAAAAAAGGTATTAAAACAATTATG
    CTAGGTGGTCAAGTTAAAGAAAATACACTTGCTACGATTGGTTCTAGTGCTATGGAGATA
    TTAAGACGATATTGTTTCGATAAAGCTTTTATCGGGATGAATGGATTAGATATTGAACTT
    GGATTAACTACTCCCGATGAGCAAGAGGCATTAGTTAAACAAACAGCAATGTCATTAGCC
    AATCAATCATTTGTACTTATAGATCATTCTAAGTTTAATAAAGTATATTTTGCTCGTGTA
    CCTTTGCTAGAAAGTACGACAATCATCACATCTGAAAAAGCATTAAATCAAGAATCGTTA
    AAAGAATACCAACAAAAGTATCACTTTATAGGAGGGACTTTATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    765

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0757 [new locus tag: SACOL_RS03890 ]
  • symbol: SACOL0757
  • description: DeoR family transcriptional regulator
  • length: 254
  • theoretical pI: 7.13005
  • theoretical MW: 28499
  • GRAVY: -0.104331

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions trehalose operon repressor (TIGR02404; HMM-score: 16.3)
    noncanonical pyrimidine nucleotidase, YjjG family (TIGR02254; EC 3.1.3.5; HMM-score: 15.9)
    and 2 more
    Metabolism Energy metabolism Amino acids and amines histidine utilization repressor (TIGR02018; HMM-score: 12.6)
    Signal transduction Regulatory functions DNA interactions histidine utilization repressor (TIGR02018; HMM-score: 12.6)
  • TheSEED  :
    • Transcriptional repressor of the fructose operon, DeoR family
    Carbohydrates Monosaccharides Fructose utilization  Transcriptional repressor of the fructose operon, DeoR family
  • PFAM:
    NADP_Rossmann (CL0063) DeoRC; DeoR C terminal sensor domain (PF00455; HMM-score: 168.3)
    and 16 more
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 58.1)
    HTH_11; HTH domain (PF08279; HMM-score: 34.7)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 23.7)
    HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 21)
    HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 19.8)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 19.4)
    Linker_histone; linker histone H1 and H5 family (PF00538; HMM-score: 18.2)
    Mga; Mga helix-turn-helix domain (PF05043; HMM-score: 18.1)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 17.8)
    AbiEi_4; Transcriptional regulator, AbiEi antitoxin (PF13338; HMM-score: 14.9)
    HTH_9; RNA polymerase III subunit RPC82 helix-turn-helix domain (PF08221; HMM-score: 14.6)
    Put_DNA-bind_N; Putative DNA-binding protein N-terminus (PF06971; HMM-score: 14.2)
    HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 14)
    DprA_WH; DprA winged helix domain (PF17782; HMM-score: 13.8)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 12.6)
    Met_repress (CL0057) SeqA_N; SeqA protein N-terminal domain (PF17206; HMM-score: 12.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effector: Fructose-6-phosphate
  • genes regulated by FruR*, TF important in Fructose utilizationRegPrecise
    repression
    fruR* > fruK > fruA*
    transcription unit transferred from N315 data RegPrecise

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9944
    • Cytoplasmic Membrane Score: 0.004
    • Cell wall & surface Score: 0.0003
    • Extracellular Score: 0.0013
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00363
    • TAT(Tat/SPI): 0.003088
    • LIPO(Sec/SPII): 0.005666
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MMIITEKRHELILEELLHKDFLTLQELIDRTGCSASTIRRDLSKLQQLGKLQRVHGGAMLKENRMVEANLTEKLATNLDEKKMIAKIAANQINDNECLFIDAGSSTLELIKYIQAKDIIVVTNGLTHVEALLKKGIKTIMLGGQVKENTLATIGSSAMEILRRYCFDKAFIGMNGLDIELGLTTPDEQEALVKQTAMSLANQSFVLIDHSKFNKVYFARVPLLESTTIITSEKALNQESLKEYQQKYHFIGGTL

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization: Cytoplasmic [1]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: FruR* (repression) regulon, CcpA regulon
    FruR*(TF)important in Fructose utilization; RegPrecise 
    CcpA(TF)important in Carbon catabolism; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]