Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1417 [new locus tag: SA_RS08000 ]
- pan locus tag?: SAUPAN004175000
- symbol: comEB
- pan gene symbol?: comEB
- synonym:
- product: late competence operon required for DNA binding and uptake comEB
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1417 [new locus tag: SA_RS08000 ]
- symbol: comEB
- product: late competence operon required for DNA binding and uptake comEB
- replicon: chromosome
- strand: -
- coordinates: 1624543..1625004
- length: 462
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124259 NCBI
- RefSeq: NP_374702 NCBI
- BioCyc: see SA_RS08000
- MicrobesOnline: 103728 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421TTGGAAAGAATCAAATGGGAAGAATATTTTATGGCACAAAGTCATTTGCTAGCATTACGT
TCAACTTGTCAAAGATTATCTGTAGGTGCAACGATTGTTAAGGATAATCGTATTATTGCT
GGTGGTTATAATGGCTCTGTAGCTGGCGAGGTGCATTGTATAGATGAAGGATGTTTAATT
GAAGATGGACATTGTATCAGAACGATACATGCAGAAATGAATGCTTTATTACAATGTGCA
AAACAAGGTGTATCTACTGAAGGTGCAACAATCTATGTTACTCATTTTCCATGCCTAAAT
TGTACAAAGTCAATTATTCAAGCAGGTATAAAGCGTATCTACTATGCAGAAGATTATCAT
AACCATGAATATGCAACTAAATTACTCAAACAATCTGGTATTGAATTTAAAAAAATTCCA
TTTTCACCAGAATATGTTGCTAAATATCTGACTAAAGGTTAA60
120
180
240
300
360
420
462
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1417 [new locus tag: SA_RS08000 ]
- symbol: ComEB
- description: late competence operon required for DNA binding and uptake comEB
- length: 153
- theoretical pI: 7.79403
- theoretical MW: 17175.7
- GRAVY: -0.164706
⊟Function[edit | edit source]
- TIGRFAM: ComE operon protein 2 (TIGR02571; HMM-score: 292.6)and 1 moreBiosynthesis of cofactors, prosthetic groups, and carriers Riboflavin, FMN, and FAD riboflavin biosynthesis protein RibD (TIGR00326; EC 1.1.1.193,3.5.4.26; HMM-score: 38.1)
- TheSEED :
- dCMP deaminase (EC 3.5.4.12)
- Late competence protein ComEB
- PFAM: CDA (CL0109) dCMP_cyt_deam_1; Cytidine and deoxycytidylate deaminase zinc-binding region (PF00383; HMM-score: 99.5)and 11 moreMafB19-deam; MafB19-like deaminase (PF14437; HMM-score: 71.7)Bd3614-deam; Bd3614-like deaminase (PF14439; HMM-score: 23.4)SNAD4; Secreted Novel AID/APOBEC-like Deaminase 4 (PF18750; HMM-score: 18.6)APOBEC2; APOBEC2 (PF18772; HMM-score: 17.8)APOBEC_N; APOBEC-like N-terminal domain (PF08210; HMM-score: 16.3)APOBEC4_like; APOBEC4-like -AID/APOBEC-deaminase (PF18774; HMM-score: 14.8)NAD2; Novel AID APOBEC clade 2 (PF18782; HMM-score: 14.5)NAD1; Novel AID APOBEC clade 1 (PF18778; HMM-score: 13.9)OTT_1508_deam; OTT_1508-like deaminase (PF14441; HMM-score: 13.3)APOBEC3; APOBEC3 (PF18771; HMM-score: 13.1)no clan defined DUF3880; DUF based on E. rectale Gene description (DUF3880) (PF12996; HMM-score: 13)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: Zn2+
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9605
- Cytoplasmic Membrane Score: 0.0015
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0378
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.090128
- TAT(Tat/SPI): 0.00771
- LIPO(Sec/SPII): 0.024472
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MERIKWEEYFMAQSHLLALRSTCQRLSVGATIVKDNRIIAGGYNGSVAGEVHCIDEGCLIEDGHCIRTIHAEMNALLQCAKQGVSTEGATIYVTHFPCLNCTKSIIQAGIKRIYYAEDYHNHEYATKLLKQSGIEFKKIPFSPEYVAKYLTKG
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: holA < SA1416 < comEB < SA1418
⊟Regulation[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Kazuya Morikawa, Yumiko Inose, Hideyuki Okamura, Atsushi Maruyama, Hideo Hayashi, Kunio Takeyasu, Toshiko Ohta
A new staphylococcal sigma factor in the conserved gene cassette: functional significance and implication for the evolutionary processes.
Genes Cells: 2003, 8(8);699-712
[PubMed:12875655] [WorldCat.org] [DOI] (P p)