From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
  • pan locus tag?: SAUPAN004175000
  • symbol: SACOL1645
  • pan gene symbol?: comEB
  • synonym:
  • product: comE operon protein 2

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
  • symbol: SACOL1645
  • product: comE operon protein 2
  • replicon: chromosome
  • strand: -
  • coordinates: 1677599..1678030
  • length: 432
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGCACAAAGTCATTTGCTAGCATTACGTTCAACTTGTCAAAGATTATCTGTAGGTGCA
    ACGATTGTTAAGGATAATCGTATTATTGCTGGTGGTTATAATGGCTCTGTAGCTGGCGAG
    GTGCATTGTATAGATGAAGGATGTTTAATTGAAGATGGACATTGTATCAGAACGATACAT
    GCAGAAATGAATGCTTTATTACAATGTGCAAAACAAGGTGTATCTACTGAAGGTGCAACA
    ATCTATGTTACTCATTTTCCATGCCTAAATTGTACAAAGTCAATTATTCAAGCAGGTATA
    AAGCGTATCTACTATGCAGAAGATTATCATAACCATGAATATGCAACTAAATTACTCAAA
    CAATCTGGTATTGAATTTAAAAAAATTCCATTTTCACCAGAATATGTTGCTAAATATCTG
    ACTAAAGGTTAA
    60
    120
    180
    240
    300
    360
    420
    432


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
  • symbol: SACOL1645
  • description: comE operon protein 2
  • length: 143
  • theoretical pI: 8.06231
  • theoretical MW: 15763.1
  • GRAVY: -0.093007

⊟Function[edit | edit source]

  • TIGRFAM:
    ComE operon protein 2 (TIGR02571; HMM-score: 270.2)
    and 1 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Riboflavin, FMN, and FAD riboflavin biosynthesis protein RibD (TIGR00326; EC 1.1.1.193,3.5.4.26; HMM-score: 38.4)
  • TheSEED  :
    • dCMP deaminase (EC 3.5.4.12)
    • Late competence protein ComEB
    DNA Metabolism DNA uptake, competence Late competence  Late competence protein ComEB
  • PFAM:
    CDA (CL0109) dCMP_cyt_deam_1; Cytidine and deoxycytidylate deaminase zinc-binding region (PF00383; HMM-score: 89.5)
    and 11 more
    MafB19-deam; MafB19-like deaminase (PF14437; HMM-score: 65.3)
    Bd3614-deam; Bd3614-like deaminase (PF14439; HMM-score: 23.5)
    SNAD4; Secreted Novel AID/APOBEC-like Deaminase 4 (PF18750; HMM-score: 18.6)
    APOBEC2; APOBEC2 (PF18772; HMM-score: 18)
    APOBEC_N; APOBEC-like N-terminal domain (PF08210; HMM-score: 16.5)
    APOBEC4_like; APOBEC4-like -AID/APOBEC-deaminase (PF18774; HMM-score: 15)
    NAD2; Novel AID APOBEC clade 2 (PF18782; HMM-score: 14.8)
    NAD1; Novel AID APOBEC clade 1 (PF18778; HMM-score: 14.3)
    OTT_1508_deam; OTT_1508-like deaminase (PF14441; HMM-score: 13.4)
    APOBEC3; APOBEC3 (PF18771; HMM-score: 13.3)
    no clan defined DUF3880; DUF based on E. rectale Gene description (DUF3880) (PF12996; HMM-score: 13.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9443
    • Cytoplasmic Membrane Score: 0.004
    • Cell wall & surface Score: 0.0007
    • Extracellular Score: 0.0511
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.122888
    • TAT(Tat/SPI): 0.00355
    • LIPO(Sec/SPII): 0.005642
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MAQSHLLALRSTCQRLSVGATIVKDNRIIAGGYNGSVAGEVHCIDEGCLIEDGHCIRTIHAEMNALLQCAKQGVSTEGATIYVTHFPCLNCTKSIIQAGIKRIYYAEDYHNHEYATKLLKQSGIEFKKIPFSPEYVAKYLTKG

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 114 [4]
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]