Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
- pan locus tag?: SAUPAN004175000
- symbol: SACOL1645
- pan gene symbol?: comEB
- synonym:
- product: comE operon protein 2
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
- symbol: SACOL1645
- product: comE operon protein 2
- replicon: chromosome
- strand: -
- coordinates: 1677599..1678030
- length: 432
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238457 NCBI
- RefSeq: YP_186485 NCBI
- BioCyc: see SACOL_RS08390
- MicrobesOnline: 913094 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGGCACAAAGTCATTTGCTAGCATTACGTTCAACTTGTCAAAGATTATCTGTAGGTGCA
ACGATTGTTAAGGATAATCGTATTATTGCTGGTGGTTATAATGGCTCTGTAGCTGGCGAG
GTGCATTGTATAGATGAAGGATGTTTAATTGAAGATGGACATTGTATCAGAACGATACAT
GCAGAAATGAATGCTTTATTACAATGTGCAAAACAAGGTGTATCTACTGAAGGTGCAACA
ATCTATGTTACTCATTTTCCATGCCTAAATTGTACAAAGTCAATTATTCAAGCAGGTATA
AAGCGTATCTACTATGCAGAAGATTATCATAACCATGAATATGCAACTAAATTACTCAAA
CAATCTGGTATTGAATTTAAAAAAATTCCATTTTCACCAGAATATGTTGCTAAATATCTG
ACTAAAGGTTAA60
120
180
240
300
360
420
432
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1645 [new locus tag: SACOL_RS08390 ]
- symbol: SACOL1645
- description: comE operon protein 2
- length: 143
- theoretical pI: 8.06231
- theoretical MW: 15763.1
- GRAVY: -0.093007
⊟Function[edit | edit source]
- TIGRFAM: ComE operon protein 2 (TIGR02571; HMM-score: 270.2)and 1 moreBiosynthesis of cofactors, prosthetic groups, and carriers Riboflavin, FMN, and FAD riboflavin biosynthesis protein RibD (TIGR00326; EC 1.1.1.193,3.5.4.26; HMM-score: 38.4)
- TheSEED :
- dCMP deaminase (EC 3.5.4.12)
- Late competence protein ComEB
- PFAM: CDA (CL0109) dCMP_cyt_deam_1; Cytidine and deoxycytidylate deaminase zinc-binding region (PF00383; HMM-score: 89.5)and 11 moreMafB19-deam; MafB19-like deaminase (PF14437; HMM-score: 65.3)Bd3614-deam; Bd3614-like deaminase (PF14439; HMM-score: 23.5)SNAD4; Secreted Novel AID/APOBEC-like Deaminase 4 (PF18750; HMM-score: 18.6)APOBEC2; APOBEC2 (PF18772; HMM-score: 18)APOBEC_N; APOBEC-like N-terminal domain (PF08210; HMM-score: 16.5)APOBEC4_like; APOBEC4-like -AID/APOBEC-deaminase (PF18774; HMM-score: 15)NAD2; Novel AID APOBEC clade 2 (PF18782; HMM-score: 14.8)NAD1; Novel AID APOBEC clade 1 (PF18778; HMM-score: 14.3)OTT_1508_deam; OTT_1508-like deaminase (PF14441; HMM-score: 13.4)APOBEC3; APOBEC3 (PF18771; HMM-score: 13.3)no clan defined DUF3880; DUF based on E. rectale Gene description (DUF3880) (PF12996; HMM-score: 13.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: Zn2+
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9443
- Cytoplasmic Membrane Score: 0.004
- Cell wall & surface Score: 0.0007
- Extracellular Score: 0.0511
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.122888
- TAT(Tat/SPI): 0.00355
- LIPO(Sec/SPII): 0.005642
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MAQSHLLALRSTCQRLSVGATIVKDNRIIAGGYNGSVAGEVHCIDEGCLIEDGHCIRTIHAEMNALLQCAKQGVSTEGATIYVTHFPCLNCTKSIIQAGIKRIYYAEDYHNHEYATKLLKQSGIEFKKIPFSPEYVAKYLTKG
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 114 [4]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)