Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_001270
- pan locus tag?: SAUPAN003611000
- symbol: JSNZ_001270
- pan gene symbol?: glpF
- synonym:
- product: MIP/aquaporin family protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_001270
- symbol: JSNZ_001270
- product: MIP/aquaporin family protein
- replicon: chromosome
- strand: +
- coordinates: 1286939..1287757
- length: 819
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781ATGAATGTATATTTAGCAGAATTCCTAGGAACTGCAATCTTAATCCTTTTTGGTGGTGGC
GTTTGTGCCAATGTCAATTTAAAGAGAAGTGCTGCGAATGGTGCTGATTGGATTGTCATC
ACAGCTGGATGGGGATTAGCGGTTACAATGGGTGTGTTTGCTGTCGGTCAATTCTCAGGT
GCACATTTAAACCCAGCGGTGTCTTTAGCTCTTGCATTAGACGGAAGTTTTGATTGGTCA
TTAGTTCCTGGTTATATTGTTGCTCAAATGTTAGGTGCAATTGTCGGAGCAACAATTGTA
TGGTTAATGTACTTGCCACATTGGAAAGCCACAGAAGAAGCTGGCGCGAAATTAGGTGTT
TTCTCTACAGCACCGGCTATTAAGAATTACTTTGCCAACTTTTTAAGTGAGATTATCGGA
ACAATGGCATTAACTTTAGGTATTTTATTTATCGGTGTAAACAAAATTGCCGATGGTTTA
AATCCTTTAATTGTCGGAGCATTAATTGTTGCAATCGGATTAAGTTTAGGCGGTGCTACT
GGTTATGCAATCAACCCAGCACGTGATTTAGGTCCGAGAATTGCACATGCGATTTTACCA
ATAGCTGGTAAAGGTGGTTCAAATTGGTCATATGCAATCGTTCCTATCTTAGGACCAATT
GCCGGTGGTTTATTAGGTGCAGTGGTATACGCTGTATTTTATAAACATACATTTAATATT
GGTTGTGCAATTGCAATTGTTGTAGTTATTATTACTTTGATTTTAGGTTACATTTTAAAT
AAATCATCAAAAAAAGGTGATATCGAATCAATTTACTAA60
120
180
240
300
360
420
480
540
600
660
720
780
819
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_001270
- symbol: JSNZ_001270
- description: MIP/aquaporin family protein
- length: 272
- theoretical pI: 8.61808
- theoretical MW: 28115.1
- GRAVY: 0.929044
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Unknown substrate MIP family channel proteins (TIGR00861; HMM-score: 196.8)and 1 moreTransport and binding proteins Cations and iron carrying compounds cation diffusion facilitator family transporter (TIGR01297; HMM-score: 12.8)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: Aquaporin-like (CL0716) MIP; Major intrinsic protein (PF00230; HMM-score: 147.1)and 2 moreno clan defined Col_cuticle_N; Nematode cuticle collagen N-terminal domain (PF01484; HMM-score: 11.4)Orthoreo_P10; Orthoreovirus membrane fusion protein p10 (PF07204; HMM-score: 10.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 10
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 7
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0001
- Cytoplasmic Membrane Score: 0.9942
- Cell wall & surface Score: 0
- Extracellular Score: 0.0057
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.168016
- TAT(Tat/SPI): 0.017261
- LIPO(Sec/SPII): 0.237234
- predicted transmembrane helices (TMHMM): 7
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MNVYLAEFLGTAILILFGGGVCANVNLKRSAANGADWIVITAGWGLAVTMGVFAVGQFSGAHLNPAVSLALALDGSFDWSLVPGYIVAQMLGAIVGATIVWLMYLPHWKATEEAGAKLGVFSTAPAIKNYFANFLSEIIGTMALTLGILFIGVNKIADGLNPLIVGALIVAIGLSLGGATGYAINPARDLGPRIAHAILPIAGKGGSNWSYAIVPILGPIAGGLLGAVVYAVFYKHTFNIGCAIAIVVVIITLILGYILNKSSKKGDIESIY
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_001270 > glpK > JSNZ_001272
⊟Regulation[edit | edit source]
- regulator: CcpA regulon
CcpA (TF) important in Carbon catabolism; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)