From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1191 [new locus tag: SAUSA300_RS06435 ]
  • pan locus tag?: SAUPAN003611000
  • symbol: glpF
  • pan gene symbol?: glpF
  • synonym:
  • product: glycerol uptake facilitator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1191 [new locus tag: SAUSA300_RS06435 ]
  • symbol: glpF
  • product: glycerol uptake facilitator
  • replicon: chromosome
  • strand: +
  • coordinates: 1312304..1313122
  • length: 819
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAATGTATATTTAGCAGAATTCCTAGGAACTGCAATCTTAATCCTTTTTGGTGGTGGC
    GTTTGTGCCAATGTCAATTTAAAGAGAAGTGCTGCGAATGGTGCTGATTGGATTGTCATC
    ACAGCTGGATGGGGATTAGCGGTTACAATGGGTGTGTTTGCTGTCGGTCAATTCTCAGGT
    GCACATTTAAACCCAGCGGTGTCTTTAGCTCTTGCATTAGACGGAAGTTTTGATTGGTCA
    TTAGTTCCTGGTTATATTGTTGCTCAAATGTTAGGTGCAATTGTCGGAGCAACAATTGTA
    TGGTTAATGTACTTGCCACATTGGAAAGCGACAGAAGAAGCTGGCGCGAAATTAGGTGTT
    TTCTCTACAGCACCGGCTATTAAGAATTACTTTGCCAACTTTTTAAGTGAGATTATCGGA
    ACAATGGCATTAACTTTAGGTATTTTATTTATCGGTGTAAACAAAATTGCCGATGGTTTA
    AATCCTTTAATTGTCGGAGCATTAATTGTTGCAATCGGATTAAGTTTAGGCGGTGCTACT
    GGTTATGCAATCAACCCAGCACGTGATTTAGGTCCGAGAATTGCACATGCGATTTTACCA
    ATAGCTGGTAAAGGTGGTTCAAATTGGTCATATGCAATCGTTCCTATCTTAGGACCAATT
    GCCGGTGGTTTATTAGGTGCAGTGGTATACGCTGTATTTTATAAACATACATTTAATATT
    GGTTGTGCAATTGCAATTGTTGTAGTTATTATTACTTTGATTTTAGGTTACATTTTAAAT
    AAATCATCAAAAAAAGGTGATATCGAATCAATTTACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    819

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1191 [new locus tag: SAUSA300_RS06435 ]
  • symbol: GlpF
  • description: glycerol uptake facilitator
  • length: 272
  • theoretical pI: 8.61808
  • theoretical MW: 28115.1
  • GRAVY: 0.929044

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate MIP family channel proteins (TIGR00861; HMM-score: 196.8)
    and 1 more
    Metabolism Transport and binding proteins Cations and iron carrying compounds cation diffusion facilitator family transporter (TIGR01297; HMM-score: 12.8)
  • TheSEED  :
    • Glycerol uptake facilitator protein
    Carbohydrates Central carbohydrate metabolism Dihydroxyacetone kinases  Glycerol uptake facilitator protein
    and 2 more
    Carbohydrates Sugar alcohols Glycerol and Glycerol-3-phosphate Uptake and Utilization  Glycerol uptake facilitator protein
    Stress Response Osmotic stress Osmoregulation  Glycerol uptake facilitator protein
  • PFAM:
    Aquaporin-like (CL0716) MIP; Major intrinsic protein (PF00230; HMM-score: 147.1)
    and 2 more
    no clan defined Col_cuticle_N; Nematode cuticle collagen N-terminal domain (PF01484; HMM-score: 11.4)
    Orthoreo_P10; Orthoreovirus membrane fusion protein p10 (PF07204; HMM-score: 10.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 7
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.0001
    • Cytoplasmic Membrane Score: 0.9942
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0057
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: 0
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.168016
    • TAT(Tat/SPI): 0.017261
    • LIPO(Sec/SPII): 0.237234
  • predicted transmembrane helices (TMHMM): 7

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNVYLAEFLGTAILILFGGGVCANVNLKRSAANGADWIVITAGWGLAVTMGVFAVGQFSGAHLNPAVSLALALDGSFDWSLVPGYIVAQMLGAIVGATIVWLMYLPHWKATEEAGAKLGVFSTAPAIKNYFANFLSEIIGTMALTLGILFIGVNKIADGLNPLIVGALIVAIGLSLGGATGYAINPARDLGPRIAHAILPIAGKGGSNWSYAIVPILGPIAGGLLGAVVYAVFYKHTFNIGCAIAIVVVIITLILGYILNKSSKKGDIESIY

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CcpA regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]