From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

FunGene: 08-OCT-2024

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_000566
  • pan locus tag?: SAUPAN002455000
  • symbol: JSNZ_000566
  • pan gene symbol?: —
  • synonym:
  • product: T7SS effector LXG polymorphic toxin

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS, pseudogene
  • locus tag: JSNZ_000566
  • symbol: JSNZ_000566
  • product: T7SS effector LXG polymorphic toxin
  • replicon: chromosome
  • strand: +
  • coordinates: 603721..603938
  • length: 218
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    ACTGCAGGTTCTATTTCGGCAATACTTGTATATTGGACCAATCAAAAAAATGAATTTGGA
    ATAAAAGATAAAAACGATTGGATAGGACATAAACTAGACGTTGGTATAGATGCTGTAGAA
    AAATCTGCAGAAAAAACAGTAGATGGTGTTGAAAATGTCATGGTGAAGCTTCAAAAAGTA
    TTTCTAATCATATAAGCCCTAAGAAATGGAGCTGGTAA
    60
    120
    180
    218

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: JSNZ_000566
  • symbol: JSNZ_000566
  • description: T7SS effector LXG polymorphic toxin
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED: data available for NCTC8325
  • PFAM:

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

⊟Protein sequence[edit | edit source]

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: LacR* (repression) regulon
    LacR*(TF)important in Lactose utilization;  regulation predicted or transferred from N315 and NCTC 8325  [2]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. ↑ Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
    Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
    Curr Res Microb Sci: 2025, 9;100489
    [PubMed:41146725] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=JSNZ_000566&oldid=106207"