Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_000566
- pan locus tag?: SAUPAN002455000
- symbol: JSNZ_000566
- pan gene symbol?: —
- synonym:
- product: T7SS effector LXG polymorphic toxin
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS, pseudogene
- locus tag: JSNZ_000566
- symbol: JSNZ_000566
- product: T7SS effector LXG polymorphic toxin
- replicon: chromosome
- strand: +
- coordinates: 603721..603938
- length: 218
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ACTGCAGGTTCTATTTCGGCAATACTTGTATATTGGACCAATCAAAAAAATGAATTTGGA
ATAAAAGATAAAAACGATTGGATAGGACATAAACTAGACGTTGGTATAGATGCTGTAGAA
AAATCTGCAGAAAAAACAGTAGATGGTGTTGAAAATGTCATGGTGAAGCTTCAAAAAGTA
TTTCTAATCATATAAGCCCTAAGAAATGGAGCTGGTAA60
120
180
218
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_000566
- symbol: JSNZ_000566
- description: T7SS effector LXG polymorphic toxin
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for NCTC8325
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- DeepLocPro:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_000554 > JSNZ_000555 > JSNZ_000556 > JSNZ_000557 > JSNZ_000558 > JSNZ_000559 > JSNZ_000560 > JSNZ_000561 > JSNZ_000562 > JSNZ_000563 > JSNZ_000564 > JSNZ_000565 > JSNZ_000566 > JSNZ_000567
⊟Regulation[edit | edit source]
- regulator: LacR* (repression) regulon
LacR* (TF) important in Lactose utilization; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)