Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_000446
- pan locus tag?: SAUPAN002247000
- symbol: JSNZ_000446
- pan gene symbol?: —
- synonym:
- product: RNA-binding S4 domain-containing protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_000446
- symbol: JSNZ_000446
- product: RNA-binding S4 domain-containing protein
- replicon: chromosome
- strand: +
- coordinates: 479399..479662
- length: 264
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGAGATTAGATAAATATTTAAAAGTATCACGGTTAATAAAGCGACGTACGCTAGCAAAA
GAAGTAAGTGATCAAGGTAGAATTACAATAAATGGTAATGTTGCTAAAGCTGGATCGGAT
GTTAAAGTTGAAGATGTGCTGACGATTCGCTTTGGTCAAAAATTAGTAACAGTTAAAGTA
ACTGCATTAAATGAATATGCATCTAAAGATAACGCGAAGGGCATGTATGAAATCGTTGAA
GAGCGTCGACTTGAAGAAGCGTAA60
120
180
240
264
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_000446
- symbol: JSNZ_000446
- description: RNA-binding S4 domain-containing protein
- length: 87
- theoretical pI: 10.2538
- theoretical MW: 9868.37
- GRAVY: -0.45977
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
- PFAM: S4 (CL0492) S4; S4 domain (PF01479; HMM-score: 37.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9979
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.0019
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010532
- TAT(Tat/SPI): 0.001595
- LIPO(Sec/SPII): 0.001612
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MRLDKYLKVSRLIKRRTLAKEVSDQGRITINGNVAKAGSDVKVEDVLTIRFGQKLVTVKVTALNEYASKDNAKGMYEIVEERRLEEA
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_000438 > glmU > JSNZ_000440 > JSNZ_000441 > pth > mfd > JSNZ_000444 > JSNZ_000445 > JSNZ_000446 > divIC > JSNZ_000448
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)