From AureoWiki
Jump to navigation Jump to search

NCBI: 01-DEC-2025

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_001579 [new locus tag: EGJ38_RS07885 ]
  • pan locus tag?: SAUPAN004175000
  • symbol: comEB
  • pan gene symbol?: comEB
  • synonym:
  • product: ComE operon protein 2

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_001579 [new locus tag: EGJ38_RS07885 ]
  • symbol: comEB
  • product: ComE operon protein 2
  • replicon: chromosome
  • strand: -
  • coordinates: 1617455..1617916
  • length: 462
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq: MGT2423536 NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    TTGGAAAGAATCAAATGGGAAGAATATTTTATGGCACAAAGTCATTTGCTAGCATTACGT
    TCAACTTGTCAAAGATTATCTGTAGGTGCAACGATTGTTAAGGATAATCGTATTATTGCT
    GGTGGTTATAATGGCTCTGTAGCTGGCGAGGTGCATTGTATAGATGAAGGATGTTTAATT
    GAAGATGGACATTGTATCAGAACGATACATGCAGAAATGAATGCTTTATTACAATGTGCA
    AAACAAGGTGTATCTACTGAAGGTGCAACAATCTATGTTACTCATTTTCCATGCCTAAAT
    TGTACAAAGTCAATTATTCAAGCAGGTATAAAGCGTATCTACTATGCAGAAGATTATCAT
    AACCATGAATATGCAACTAAATTACTCAAACAATCTGGTATTGAATTTAAAAAAATTCCA
    TTTTCACCAGAATATGTTGCTAAATATCTGACTAAAGGTTAA
    60
    120
    180
    240
    300
    360
    420
    462

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: EGJ38_001579 [new locus tag: EGJ38_RS07885 ]
  • symbol: ComEB
  • description: ComE operon protein 2
  • length: 153
  • theoretical pI: 7.79403
  • theoretical MW: 17175.7
  • GRAVY: -0.164706

Function[edit | edit source]

  • TIGRFAM:
    ComE operon protein 2 (TIGR02571; HMM-score: 292.6)
    and 1 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Riboflavin, FMN, and FAD riboflavin biosynthesis protein RibD (TIGR00326; EC 1.1.1.193,3.5.4.26; HMM-score: 38.1)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    CDA (CL0109) dCMP_cyt_deam_1; Cytidine and deoxycytidylate deaminase zinc-binding region (PF00383; HMM-score: 99.5)
    and 11 more
    MafB19-deam; MafB19-like deaminase (PF14437; HMM-score: 71.7)
    Bd3614-deam; Bd3614-like deaminase (PF14439; HMM-score: 23.4)
    SNAD4; Secreted Novel AID/APOBEC-like Deaminase 4 (PF18750; HMM-score: 18.6)
    APOBEC2; APOBEC2 (PF18772; HMM-score: 17.8)
    APOBEC_N; APOBEC-like N-terminal domain (PF08210; HMM-score: 16.3)
    APOBEC4_like; APOBEC4-like -AID/APOBEC-deaminase (PF18774; HMM-score: 14.8)
    NAD2; Novel AID APOBEC clade 2 (PF18782; HMM-score: 14.5)
    NAD1; Novel AID APOBEC clade 1 (PF18778; HMM-score: 13.9)
    OTT_1508_deam; OTT_1508-like deaminase (PF14441; HMM-score: 13.3)
    APOBEC3; APOBEC3 (PF18771; HMM-score: 13.1)
    no clan defined DUF3880; DUF based on E. rectale Gene description (DUF3880) (PF12996; HMM-score: 13)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9605
    • Cytoplasmic Membrane Score: 0.0015
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0378
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.090128
    • TAT(Tat/SPI): 0.00771
    • LIPO(Sec/SPII): 0.024472
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: MGT2423536 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MERIKWEEYFMAQSHLLALRSTCQRLSVGATIVKDNRIIAGGYNGSVAGEVHCIDEGCLIEDGHCIRTIHAEMNALLQCAKQGVSTEGATIYVTHFPCLNCTKSIIQAGIKRIYYAEDYHNHEYATKLLKQSGIEFKKIPFSPEYVAKYLTKG

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigH regulon
    SigH(sigma factor)controlling competence and phage integrase genes;  [2]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. Kazuya Morikawa, Yumiko Inose, Hideyuki Okamura, Atsushi Maruyama, Hideo Hayashi, Kunio Takeyasu, Toshiko Ohta
    A new staphylococcal sigma factor in the conserved gene cassette: functional significance and implication for the evolutionary processes.
    Genes Cells: 2003, 8(8);699-712
    [PubMed:12875655] [WorldCat.org] [DOI] (P p)

Relevant publications[edit | edit source]