From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02810
  • symbol: SAOUHSC_02810
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2588793..2589557
  • length: 765
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAACTATTCGACTGGAGAACTCGCAAAATTATGCAATGTGACAACACGAACGATT
    CAATATTATGATCGCAAAGGTATTTTGAAACCACAAGGATTTACAGAAGGAAAGCGTCGT
    GTGTATACAGAACAACAGCGACAAACATTAGAGTTAATCTTATTGCTTAAAGATTTAGGT
    TGTGCGTTAAGCGATATAGATATGTTGCTAAAAGGTGAAGGTACTTTGAAGACGCTCAAT
    ACTTTACTAACTATGAAACAACAAGAAATTAACCAACAAGTTAAACAGCAACAAGCGGTA
    TTAAACAAAATTAAAAATGTTCAATATTACGTAAATGAAGCGTCGACGTCTCCAATCACA
    CACTTAAAAGACATAGAGCATGTCATGAGTAAATCAGCTGAAATGAAAAGTATTCGTCGT
    AACATTTGGATTAGTGCTGGTATTATAGGAATAATTCAATATTCTAGCATTATAAGTGCA
    ATTTTGATGAAAAATAAATGGCCGTTTTTAATTGCTTTACCATTTATGATTGGTTATGGC
    ATTGGTGTTACTTTTTATTACCAACAAAAGGTTGCCTATTTATGTCCTAACTGCCAGCAT
    ATATTCTCACCATCTTTGTGGGCAGTTATCAAAGCGAAACATACAGCGACAACACGTCGA
    TTCGAATGTCCAAACTGTCATGAAACGCATTATTGCATTGAAGTACCTAAAGCGCATATG
    AGTACAGAACAATTAGAAATATCCCACATACAACATAACAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    765

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_02810
  • symbol: SAOUHSC_02810
  • description: hypothetical protein
  • length: 254
  • theoretical pI: 9.42155
  • theoretical MW: 29141.8
  • GRAVY: -0.238189

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions Zn(II)-responsive transcriptional regulator (TIGR02043; HMM-score: 59)
    and 8 more
    Cellular processes Cellular processes Detoxification Hg(II)-responsive transcriptional regulator (TIGR02051; HMM-score: 44.9)
    Signal transduction Regulatory functions DNA interactions Hg(II)-responsive transcriptional regulator (TIGR02051; HMM-score: 44.9)
    Signal transduction Regulatory functions DNA interactions Cd(II)/Pb(II)-responsive transcriptional regulator (TIGR02047; HMM-score: 44.5)
    Signal transduction Regulatory functions DNA interactions Cu(I)-responsive transcriptional regulator (TIGR02044; HMM-score: 40.5)
    Cellular processes Cellular processes Detoxification redox-sensitive transcriptional activator SoxR (TIGR01950; HMM-score: 19.6)
    Signal transduction Regulatory functions DNA interactions redox-sensitive transcriptional activator SoxR (TIGR01950; HMM-score: 19.6)
    cxxc_20_cxxc protein (TIGR04104; HMM-score: 16.1)
    MJ0042 family finger-like domain (TIGR02098; HMM-score: 5.7)
  • TheSEED  :
    • Transcriptional regulator, MerR family
    Virulence, Disease and Defense Resistance to antibiotics and toxic compounds Cobalt-zinc-cadmium resistance  Transcriptional regulator, MerR family
  • PFAM:
    HTH (CL0123) MerR_1; MerR HTH family regulatory protein (PF13411; HMM-score: 61.7)
    and 25 more
    MerR; MerR family regulatory protein (PF00376; HMM-score: 46.7)
    HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 19.6)
    MerR-DNA-bind; MerR, DNA binding (PF09278; HMM-score: 18.8)
    RING (CL0229) C1_4; TFIIH C1-like domain (PF07975; HMM-score: 17)
    Zn_Beta_Ribbon (CL0167) HVO_2753_ZBP; Small zinc finger protein HVO_2753-like, Zn-binding pocket (PF07754; HMM-score: 16.8)
    Zn_ribbon_4; zinc-ribbon domain (PF13717; HMM-score: 15.4)
    Tbcl_zf (CL0839) DUF4379; Probable Treble clef zinc finger domain (PF14311; HMM-score: 14.6)
    no clan defined RAC_head; Ribosome-associated complex head domain (PF16717; HMM-score: 14.5)
    Zn_Beta_Ribbon (CL0167) Zn_ribbon_8; Zinc ribbon domain (PF09723; HMM-score: 14)
    Zn_ribbon_20; Zinc beta-ribbon domain (PF23551; HMM-score: 13.8)
    C2H2-zf (CL0361) zf-Di19; Drought induced 19 protein (Di19), zinc-binding (PF05605; HMM-score: 12.1)
    Zn_Beta_Ribbon (CL0167) Cas12f1-like_TNB; Cas12f1-like, TNB domain (PF07282; HMM-score: 11.8)
    Zn_ribbon_16; Zinc beta-ribbon finger, putative (PF21957; HMM-score: 11.8)
    Zn_ribbon_10; ER junction formation factor lunapark, zinc ribbon finger (PF10058; HMM-score: 10.9)
    no clan defined Opy2; Opy2 protein (PF09463; HMM-score: 10.8)
    Zn_Beta_Ribbon (CL0167) Zn_ribbon_FGT1_1; FORGETTER1 first zinc ribbon domain (PF23547; HMM-score: 10.6)
    Zn_ribbon_Nudix; Nudix N-terminal (PF14803; HMM-score: 10.3)
    Zn_ribbon_TFIIS; Transcription factor S-II (TFIIS) (PF01096; HMM-score: 10.2)
    no clan defined SlyX; SlyX (PF04102; HMM-score: 10.1)
    Tbcl_zf (CL0839) zf_Rg; Reverse gyrase zinc finger (PF17915; HMM-score: 10.1)
    no clan defined DUF7385; Family of unknown function (DUF7385) (PF24110; HMM-score: 8.9)
    C2H2-zf (CL0361) zf-H2C2_2; Zinc-finger double domain (PF13465; HMM-score: 8.5)
    Zn_Beta_Ribbon (CL0167) DUF7560; Family of unknown function (DUF7560) (PF24441; HMM-score: 8.1)
    CpXC; CpXC protein (PF14353; HMM-score: 7)
    no clan defined YnfU; YnfU (PF23499; HMM-score: 6.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 2
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.0141
    • Cytoplasmic Membrane Score: 0.9533
    • Cell wall & surface Score: 0.0041
    • Extracellular Score: 0.0284
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004422
    • TAT(Tat/SPI): 0.000282
    • LIPO(Sec/SPII): 0.000685
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSNYSTGELAKLCNVTTRTIQYYDRKGILKPQGFTEGKRRVYTEQQRQTLELILLLKDLGCALSDIDMLLKGEGTLKTLNTLLTMKQQEINQQVKQQQAVLNKIKNVQYYVNEASTSPITHLKDIEHVMSKSAEMKSIRRNIWISAGIIGIIQYSSIISAILMKNKWPFLIALPFMIGYGIGVTFYYQQKVAYLCPNCQHIFSPSLWAVIKAKHTATTRRFECPNCHETHYCIEVPKAHMSTEQLEISHIQHNN

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

  • S.aureus Expression Data Browser:  [3] 
    Expression Data Browser
    Multi-gene expression profiles



    Click on any data point to display a description of the corresponding condition!

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Jump up to: 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]