Jump to navigation
Jump to search
COLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: S1094 [1]
- symbol: S1094
- synonym:
- product: RNA feature, intergenic transcript
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: misc_RNA
- locus tag: S1094 [1]
- symbol: S1094
- product: RNA feature, intergenic transcript
- replicon: chromosome
- strand: -
- coordinates: 2589558..2589721
- length: 164
- essential: unknown
⊟Accession numbers[edit | edit source]
- SRD:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121ATGTTTAGTAGGTGTGTTACTTAGTTTGAGTGAGTTTGTAAATCAACATGGTACGAAATC
ATAAAAATAAGACGCCTAGTATAATAAATTTCTTTAAAATGTGGAAATTGTACTTGCTCG
TGACGTCGGGTCATCAACTATGGTAATTATAGGAGGTGGAATCT60
120
164
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- predicted SigA promoter [1] : SAOUHSC_02810 < S1094 < SAOUHSC_02811
⊟Regulation[edit | edit source]
- regulator: VraR* (activation) regulon
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [1]
Multi-gene expression profiles
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2 1.3 1.4 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
Mol Microbiol: 2003, 49(3);807-21
[PubMed:12864861] [WorldCat.org] [DOI] (P p) - ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)