Navigation

  • Main page
  • Downloads
  • Getting Started
  • Recent changes
  • Random page
  • What links here
  • Related changes
  • Special pages
  • Printable version
  • Permanent link
  • Page information

personal-loginout

  • Log in
  • Not logged in
  • Talk
  • Contributions
  • Create account

Search

?

Navigation menu

Namespaces
  • Page
  • Discussion
English
From AureoWiki
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159JSNZLGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40


Views
  • Read
  • Edit
  • History
  • Edit source

⊟Summary[edit | edit source]

Contents

  • 1 Summary
  • 2 Genome View
  • 3 Gene
    • 3.1 General
    • 3.2 Accession numbers
    • 3.3 Phenotype
    • 3.4 DNA sequence
  • 4 Expression & Regulation
    • 4.1 Operon
    • 4.2 Regulation
    • 4.3 Transcription pattern
  • 5 Biological Material
    • 5.1 Mutants
    • 5.2 Expression vector
    • 5.3 lacZ fusion
    • 5.4 GFP fusion
    • 5.5 two-hybrid system
    • 5.6 FLAG-tag construct
    • 5.7 Antibody
  • 6 Other Information
  • 7 Literature
    • 7.1 References
    • 7.2 Relevant publications
  • organism: Staphylococcus aureus NCTC8325
  • locus tag: S654 [1]
  • symbol: S654
  • synonym:
  • product: RNA feature, intergenic transcript

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: misc_RNA
  • locus tag: S654 [1]
  • symbol: S654
  • product: RNA feature, intergenic transcript
  • replicon: chromosome
  • strand: -
  • coordinates: 1570102..1570204
  • length: 103
  • essential: unknown

⊟Accession numbers[edit | edit source]

  • SRD:

⊟Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    AATGCGATAAATAAAACTTGAAGGGGGCATATCTCTTTATTTTGTCTAATTTTGAGTCGT
    AAACATTACTGTTTACATATGTTACTAGGAGTTGTATAGTTGA
    60
    103

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

  • predicted SigA promoter [1] : SAOUHSC_01655 < SAOUHSC_01656 < SAOUHSC_01657 < S654 < SAOUHSC_01658 < SAOUHSC_01659
    predicted SigA promoter [1] : SAOUHSC_01655 < SAOUHSC_01656 < SAOUHSC_01657 < S654 < SAOUHSC_01658 < SAOUHSC_01659 < S655 < SAOUHSC_01660 < SAOUHSC_01661 < SAOUHSC_01662 < S656 < SAOUHSC_01663

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

  • S.aureus Expression Data Browser:  [1] 
    Expression Data Browser
    ⊟Multi-gene expression profiles



    Click on any data point to display a description of the corresponding condition!


⊞Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊞Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Jump up to: 1.0 1.1 1.2 1.3 1.4 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=S654&oldid=103382"
  • This page was last edited on 12 February 2019, at 18:09.
  • Privacy and Cookies
  • About AureoWiki
  • Imprint
We use Matomo for user statistics and cookies. Privacy and Cookies X
CancelTry again