Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS02395 [old locus tag: SA0420 ]
- pan locus tag?: SAUPAN002176000
- symbol: SA_RS02395
- pan gene symbol?: metN2
- synonym:
- product: methionine import ATP-binding protein MetN 1
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021ATGATTGAGTTTCGACAAGTTAGTAAATCATTTCATAAGAAAAAGCAAACAATAGATGCT
TTGAAGGACGTATCATTTACGGTCAATCGCAATGATATTTTTGGTGTGATTGGATATAGT
GGTGCAGGAAAAAGTACGTTGGTAAGACTCGTGAATCATCTTGAAGCTGCCTCGAATGGA
CAAGTGATTGTAGATGGACATGATATTACGAATTATAGCGAAAAAGGCATGCGAGAAATT
AAGAAAGATATCGGTATGATATTTCAGCATTTCAATTTATTAAATTCAGCTACGGTATTT
AAAAATGTAGCAATGCCACTCATTTTAAGTAAGAAAAGCAAAACAGAAATTAAGCAACGA
GTAACGGAAATGCTTGAATTTGTAGGATTGAGTGATAAAAAAGACCAATTTCCTGATGAA
TTATCTGGTGGGCAGAAGCAAAGGGTGGCTATTGCAAGAGCGCTTGTTACTAATCCGAAA
ATACTCCTATGCGATGAAGCAACAAGCGCATTGGATCCAGCAACGACTGCTTCGATATTG
ACGTTATTAAAGAATGTCAATCAAACCTTTGGCATTACAATTATGATGATTACACATGAA
ATGCGCGTTATTAAAGACATTTGTAATCGTGTTGCTGTAATGGAAAAGGGGCAAGTGGTT
GAAACAGGAACTGTTAAAGAGGTGTTTAGTCATCCTAAAACGACGATTGCTCAAAATTTT
GTGTCTACAGTTATACAGACTGAGCCAAGTACATCATTGATTCGTCGATTGAATGACGAA
CAAGTTGGCGGTTTTAAAGATTATAAAATCTTCGTCGAGGAAACTCAGGTGACACAACCG
ATTATAAATGACTTGATTCAAATTTGTGGCAGAGAGGTTAAAATTTTATTTTCATCTATG
TCAGAAATACAAGGTAACACCGTATGTTATATGTGGCTTCGATTTAATATAGATCAACAA
TTTGATGACACGGCAATAAATCAATATTTCAAAGAGAAAAATATTCAATTTGAGGAGGTG
CATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1026
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS02395 [old locus tag: SA0420 ]
- symbol: SA_RS02395
- description: methionine import ATP-binding protein MetN 1
- length: 341
- theoretical pI: 7.99001
- theoretical MW: 38521.2
- GRAVY: -0.177713
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 377.1)and 70 moreCellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 226.5)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 215.9)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 211.4)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 207.2)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 207.2)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 206)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 205.3)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 198.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 196.3)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 194.5)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 192.2)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 191.1)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 187.1)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 179.9)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.1)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.1)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 174.8)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 165.7)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 152.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 152.7)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 149)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 149)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 147.5)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 144)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 144)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.2)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 140.3)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 139.4)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 139.4)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 138.1)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 136)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 135.2)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 135.2)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 133.4)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 131.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 128.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 128.7)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 128.7)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 127.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 125.4)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 125.4)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 117.7)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 115.3)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 115.3)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 111.2)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 110.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 110.3)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 108.4)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 105.3)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 104.1)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 104.1)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 104.1)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 103.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 102.2)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 96.7)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 96.5)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 91.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 90.1)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 84)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 84)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 81.6)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 78.1)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 67.9)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 59.5)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 55.6)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 55.6)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 54)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 42.1)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 34)
- TheSEED: see SA0420
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 130)and 15 moreACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 42.1)P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 28.4)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 24.5)AAA_22; AAA domain (PF13401; HMM-score: 21.2)AAA_16; AAA ATPase domain (PF13191; HMM-score: 18.8)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 16.2)AAA_30; AAA domain (PF13604; HMM-score: 16.1)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.9)ABC_ATPase; P-loop domain (PF09818; HMM-score: 14.6)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 13.9)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 13.8)AAA_18; AAA domain (PF13238; HMM-score: 13.5)NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.1)AAA_23; AAA domain (PF13476; HMM-score: 13.1)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 12.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.1993
- Cytoplasmic Membrane Score: 0.7563
- Cell wall & surface Score: 0.0012
- Extracellular Score: 0.0432
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007147
- TAT(Tat/SPI): 0.003036
- LIPO(Sec/SPII): 0.000637
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIEFRQVSKSFHKKKQTIDALKDVSFTVNRNDIFGVIGYSGAGKSTLVRLVNHLEAASNGQVIVDGHDITNYSEKGMREIKKDIGMIFQHFNLLNSATVFKNVAMPLILSKKSKTEIKQRVTEMLEFVGLSDKKDQFPDELSGGQKQRVAIARALVTNPKILLCDEATSALDPATTASILTLLKNVNQTFGITIMMITHEMRVIKDICNRVAVMEKGQVVETGTVKEVFSHPKTTIAQNFVSTVIQTEPSTSLIRRLNDEQVGGFKDYKIFVEETQVTQPIINDLIQICGREVKILFSSMSEIQGNTVCYMWLRFNIDQQFDDTAINQYFKEKNIQFEEVH
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SA_RS09855 (gatA) glutamyl-tRNA(Gln) amidotransferase subunit A [1] (data from MRSA252) SA_RS00150 DNA polymerase III subunit beta [1] (data from MRSA252) SA_RS02955 elongation factor G [1] (data from MRSA252) SA_RS02960 elongation factor Tu [1] (data from MRSA252) SA_RS04575 NADH dehydrogenase [1] (data from MRSA252) SA_RS04710 hypothetical protein [1] (data from MRSA252) SA_RS05360 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) SA_RS05945 carbamoyl-phosphate synthase large chain [1] (data from MRSA252) SA_RS06225 30S ribosomal protein S2 [1] (data from MRSA252) SA_RS07685 acetyl-CoA carboxylase biotin carboxylase subunit [1] (data from MRSA252) SA_RS07950 molecular chaperone DnaJ [1] (data from MRSA252) SA_RS08505 aldehyde dehydrogenase [1] (data from MRSA252) SA_RS08545 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) SA_RS08560 pyruvate kinase [1] (data from MRSA252) SA_RS08625 universal stress protein UspA [1] (data from MRSA252) SA_RS09055 S-adenosylmethionine synthase [1] (data from MRSA252) SA_RS09850 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B [1] (data from MRSA252) SA_RS11245 glutamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) SA_RS11680 30S ribosomal protein S5 [1] (data from MRSA252) SA_RS11705 50S ribosomal protein L5 [1] (data from MRSA252) SA_RS11735 30S ribosomal protein S3 [1] (data from MRSA252) SA_RS13375 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CymR* see SA0420
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)