From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2568 [new locus tag: SAUSA300_RS14285 ]
  • pan locus tag?: SAUPAN006362000
  • symbol: arcD
  • pan gene symbol?: arcD
  • synonym:
  • product: arginine/ornithine antiporter

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_2568 [new locus tag: SAUSA300_RS14285 ]
  • symbol: arcD
  • product: arginine/ornithine antiporter
  • replicon: chromosome
  • strand: -
  • coordinates: 2779150..2780580
  • length: 1431
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGAACGAATCAGGAGATAACAAACTCAGTAAATCTTCTTTAATTGGACTAGTTATAGGA
    TCCATGATTGGTGGCGGTGCGTTCAATATAATGTCTGATATGGGCGGTAAAGCCGGTGGA
    TTAGCCATTATTATTGGTTGGATTATTACAGCTATAGGAATGATTTCATTAGCGTTCGTA
    TTTCAAAATTTAACCAATGAACGGCCGGAGCTAGACGGTGGTATTTATAGTTATGCTCAA
    GCAGGATTTGGCGATTTTGTAGGATTTATCAGTGCTTGGGGATATTGGTTCTCAGCGTTT
    TTAGGCAATGTTGCCTATGCAACACTATTGATGTCAGCAGTAGGTAACTTTTTCCCGATT
    TTTAAAGGAGGCAACACATTACCAAGTGTTATTGTCGCCTCGTTACTACTCTGGGGTGTC
    CATTTCTTGATTTTAAAAGGCGTTGAAACAGCAGCATTTATCAATAGTATTGTTACTGTT
    GCAAAGTTAATACCGATTTTACTTGTAATCATATGCATGATAATTGCATTCAATTTTGAC
    ACTTTTAAAACAGGCTTTTTCAGTATGACGTCAGAGGGTGTATTGCCATTTAGTTGGGCG
    AGCACAATGAGCCAAGTTAAAAGTACGATGCTAGTGACAGTTTGGGTGTTTATCGGTATC
    GAAGGTGCAGTAATTTTTTCTAGTAGAGCTAAAAATAAAAAAGATGTAGGTAGTGCCACG
    GTTATAGGACTTATATCAGTTTTAATTATCTATTTCTTATTAACTGTATTAGCTCAAGGC
    GTGATTTTGCAAAATCATATTTCGCAATTAGATTCGCCAAGTATGGCACAGGTGCTTGCA
    ACTATTGTAGGTGGTTGGGGATCTACACTTGTAAATATTGGTTTAATTATTTCGGTACTA
    GGTGCATGGTTAGGATGGACACTGCTTGCTGGTGAATTACCTTTCATTGTTGCAAAAGAT
    GGATTATTTCCAAAATGGTTTGCTAAAGAAAATAAAAATGGAGCACCTGTAAATGCACTG
    CTTATTACCAATATATTAGTACAATTATTTTTAATAAGTATGCTATTTACACAGAGTGCG
    TATCAATTTGCATTTTCACTAGCATCAAGTGCTATTTTATACCCTTACATGTTCAGTGCA
    TTTTACCAAGTTAAATACACTTTAGAGCATCGACAGCAAGCAACTACTAAACAATGGACG
    ATTGGTATCATAGCCTCAATTTATGCTATATGGCTTATATATGCAGCAGGTATCAATTAC
    TTATTATTGACGATGTTACTTTATATTCCAGCTCTTCTTGTTTATACAATCGTTCAAAAG
    AATAATCAGACACGTTTGATTAAATCAGACTATATTCTTTTTATGATTATTATCGTACTT
    GCAGTTATCGGGTTAATTAAGTTATTGATGGGAACGATAAATGTTTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1431

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_2568 [new locus tag: SAUSA300_RS14285 ]
  • symbol: ArcD
  • description: arginine/ornithine antiporter
  • length: 476
  • theoretical pI: 9.50412
  • theoretical MW: 51716.2
  • GRAVY: 0.907983

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Amino acids, peptides and amines arginine-ornithine antiporter (TIGR03810; HMM-score: 619.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines transporter, basic amino acid/polyamine antiporter (APA) family (TIGR00905; HMM-score: 568.9)
    and 8 more
    histidine-histamine antiporter (TIGR04298; HMM-score: 140)
    Metabolism Transport and binding proteins Amino acids, peptides and amines amino acid transporter (TIGR00909; HMM-score: 99)
    putrescine-ornithine antiporter (TIGR04299; HMM-score: 81.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cationic amino acid transport permease (TIGR00906; HMM-score: 59.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines amino acid permease (yeast) (TIGR00913; HMM-score: 51.9)
    putative glutamate/gamma-aminobutyrate antiporter (TIGR03813; HMM-score: 46.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glutamate:gamma-aminobutyrate antiporter (TIGR00910; HMM-score: 24.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines spore germination protein (amino acid permease) (TIGR00912; HMM-score: 21.5)
  • TheSEED  :
    • Arginine/ornithine antiporter ArcD
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation  Arginine/ornithine antiporter ArcD
    and 2 more
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Deiminase Pathway  Arginine/ornithine antiporter ArcD
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Polyamine Metabolism  Arginine/ornithine antiporter ArcD
  • PFAM:
    APC (CL0062) AA_permease_2; Amino acid permease (PF13520; HMM-score: 226.4)
    and 4 more
    AA_permease; Amino acid permease (PF00324; HMM-score: 89.1)
    Spore_permease; Spore germination protein (PF03845; HMM-score: 29.7)
    no clan defined YwiC; YwiC-like protein (PF14256; HMM-score: 16.9)
    Gemini_mov; Geminivirus putative movement protein (PF01708; HMM-score: 13)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 13
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9998
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0002
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.012824
    • TAT(Tat/SPI): 0.000841
    • LIPO(Sec/SPII): 0.020508
  • predicted transmembrane helices (TMHMM): 14

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNESGDNKLSKSSLIGLVIGSMIGGGAFNIMSDMGGKAGGLAIIIGWIITAIGMISLAFVFQNLTNERPELDGGIYSYAQAGFGDFVGFISAWGYWFSAFLGNVAYATLLMSAVGNFFPIFKGGNTLPSVIVASLLLWGVHFLILKGVETAAFINSIVTVAKLIPILLVIICMIIAFNFDTFKTGFFSMTSEGVLPFSWASTMSQVKSTMLVTVWVFIGIEGAVIFSSRAKNKKDVGSATVIGLISVLIIYFLLTVLAQGVILQNHISQLDSPSMAQVLATIVGGWGSTLVNIGLIISVLGAWLGWTLLAGELPFIVAKDGLFPKWFAKENKNGAPVNALLITNILVQLFLISMLFTQSAYQFAFSLASSAILYPYMFSAFYQVKYTLEHRQQATTKQWTIGIIASIYAIWLIYAAGINYLLLTMLLYIPALLVYTIVQKNNQTRLIKSDYILFMIIIVLAVIGLIKLLMGTINVF

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: ArcR (activation) regulon, ArgR/AhrC (repression) regulon, CcpA regulon, Rex (repression) regulon
    ArcR(TF)important in Arginine degradation; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    ArgR/AhrC(TF)important in Arginine biosynthesis, Arginine degradation; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    Rex(TF)important in Energy metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]