Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1186 [new locus tag: SAUSA300_RS06410 ]
- pan locus tag?: SAUPAN003597000
- symbol: SAUSA300_1186
- pan gene symbol?: ricA
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1186 [new locus tag: SAUSA300_RS06410 ]
- symbol: SAUSA300_1186
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1305465..1305830
- length: 366
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3914896 NCBI
- RefSeq: YP_493883 NCBI
- BioCyc: see SAUSA300_RS06410
- MicrobesOnline: 1292701 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAATAAAGATGACGTGTTGAACCAAGCGGATAATATTGCAAATAAAATTAAAAAT
TTGGATACTATCAAAACATATCAACAAATTGAAGCACAGATTCATCAGAACCAAACGATA
AAGACTAAAATGGATATGTTAAAAAAGCATCAAAAACAAGCAGTAAACTTTCAAAATTAC
GGGAAACAAAATGCGCTAGAACAGTCGGAACATACCATTCAGAGTATAGAAGCAGAAATA
AATACATTGCCCATAGTTGAACAGTTTCAAACTTCACAATATGAAGCGAATCAATTATTG
AAAATGTTTGTATCAACAATGGAAACACGTTTAAATGACCATAATAAAGCCAAGCATAGT
GATTAA60
120
180
240
300
360
366
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1186 [new locus tag: SAUSA300_RS06410 ]
- symbol: SAUSA300_1186
- description: hypothetical protein
- length: 121
- theoretical pI: 7.08949
- theoretical MW: 14149.8
- GRAVY: -0.97686
⊟Function[edit | edit source]
- TIGRFAM: hopanoid biosynthesis associated RND transporter like protein HpnN (TIGR03480; HMM-score: 8)DNA metabolism DNA replication, recombination, and repair CDK-activating kinase assembly factor MAT1 (TIGR00570; HMM-score: 7.4)
- TheSEED :
- FIG01107972: hypothetical protein
- PFAM: no clan defined Com_YlbF; Control of competence regulator ComK, YlbF/YmcA (PF06133; HMM-score: 56.3)and 7 moreCemA; CemA family (PF03040; HMM-score: 12.2)MMS21_N; E3 SUMO-protein ligase MMS21, N-terminal domain (PF22326; HMM-score: 12.1)Ycf34; Hypothetical chloroplast protein Ycf34 (PF10718; HMM-score: 11.6)Enkurin; Calmodulin-binding (PF13864; HMM-score: 10.9)P-loop_NTPase (CL0023) DUF6079; Family of unknown function (DUF6079) (PF19557; HMM-score: 10.8)no clan defined ABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 10.5)PAS_Fold (CL0183) PAS_13; ERT1/acuK family PAS domain (PF24990; HMM-score: 9.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9823
- Cytoplasmic Membrane Score: 0.0094
- Cell wall & surface Score: 0.0009
- Extracellular Score: 0.0075
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010641
- TAT(Tat/SPI): 0.000469
- LIPO(Sec/SPII): 0.001477
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYNKDDVLNQADNIANKIKNLDTIKTYQQIEAQIHQNQTIKTKMDMLKKHQKQAVNFQNYGKQNALEQSEHTIQSIEAEINTLPIVEQFQTSQYEANQLLKMFVSTMETRLNDHNKAKHSD
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.