From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1135 [new locus tag: SA_RS06415 ]
  • pan locus tag?: SAUPAN003597000
  • symbol: SA1135
  • pan gene symbol?: ricA
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1135 [new locus tag: SA_RS06415 ]
  • symbol: SA1135
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1289842..1290207
  • length: 366
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGTATAATAAAGATGACGTGTTGAAACAAGCGGATAATATTGCAAATAAAATTAAAAAT
    TTGGATACTATCAAAACATATCAACAAATTGAAGCACAGATTCATCAGAACCAAACGATA
    AAGACTAAAATGGATATGTTAAAAAAGCATCAAAAACAAGCAGTAAACTTTCAAAATTAC
    GGGAAACAAAATGCGCTAGAACAGTCGGAACATACCATTCAAAGTATAGAAGCAGAAATA
    AATACATTGCCCATAGTTGAACAGTTTCAAACTTCACAATATGAAGCGAATCAATTATTG
    AAAATGTTTGTATCAACAATGGAAACACGTTTAAATGACCATAATAAAGCCAAGCATAGT
    GATTAA
    60
    120
    180
    240
    300
    360
    366

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1135 [new locus tag: SA_RS06415 ]
  • symbol: SA1135
  • description: hypothetical protein
  • length: 121
  • theoretical pI: 7.8816
  • theoretical MW: 14163.9
  • GRAVY: -0.980165

Function[edit | edit source]

  • TIGRFAM:
    hopanoid biosynthesis associated RND transporter like protein HpnN (TIGR03480; HMM-score: 8.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair CDK-activating kinase assembly factor MAT1 (TIGR00570; HMM-score: 7)
  • TheSEED  :
    • Regulatory iron-sulfur containing complex subunit RicA
  • PFAM:
    no clan defined Com_YlbF; Control of competence regulator ComK, YlbF/YmcA (PF06133; HMM-score: 56.1)
    and 7 more
    MMS21_N; E3 SUMO-protein ligase MMS21, N-terminal domain (PF22326; HMM-score: 12.1)
    CemA; CemA family (PF03040; HMM-score: 12)
    Ycf34; Hypothetical chloroplast protein Ycf34 (PF10718; HMM-score: 11.6)
    Enkurin; Calmodulin-binding (PF13864; HMM-score: 10.9)
    P-loop_NTPase (CL0023) DUF6079; Family of unknown function (DUF6079) (PF19557; HMM-score: 10.7)
    no clan defined ABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 10.1)
    PAS_Fold (CL0183) PAS_13; ERT1/acuK family PAS domain (PF24990; HMM-score: 8.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9802
    • Cytoplasmic Membrane Score: 0.0114
    • Cell wall & surface Score: 0.0011
    • Extracellular Score: 0.0074
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010146
    • TAT(Tat/SPI): 0.000457
    • LIPO(Sec/SPII): 0.001217
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MYNKDDVLKQADNIANKIKNLDTIKTYQQIEAQIHQNQTIKTKMDMLKKHQKQAVNFQNYGKQNALEQSEHTIQSIEAEINTLPIVEQFQTSQYEANQLLKMFVSTMETRLNDHNKAKHSD

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]