Jump to navigation
Jump to search
NCBI: 01-DEC-2025
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_001265 [new locus tag: EGJ38_RS06320 ]
- pan locus tag?: SAUPAN003597000
- symbol: ricA
- pan gene symbol?: ricA
- synonym:
- product: RicAFT regulatory complex protein RicA family protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_001265 [new locus tag: EGJ38_RS06320 ]
- symbol: ricA
- product: RicAFT regulatory complex protein RicA family protein
- replicon: chromosome
- strand: +
- coordinates: 1280090..1280455
- length: 366
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq: MGT2423230 NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAATAAAGATGACGTGTTGAAACAAGCGGATAATATTGCAAATAAAATTAAAAAT
TTGGATACTATCAAAACATATCAACAAATTGAAGCACAGATTCATCAGAACCAAACGATA
AAGACTAAAATGGATATGTTAAAAAAGCATCAAAAACAAGCAGTAAACTTTCAAAATTAC
GGGAAACAAAATGCGCTAGAACAGTCGGAACATACCATTCAAAGTATAGAAGCAGAAATA
AATACATTGCCCATAGTTGAACAGTTTCAAACTTCACAATATGAAGCGAATCAATTATTG
AAAATGTTTGTATCAACAATGGAAACACGTTTAAATGACCATAATAAAGCCAAGCATAGT
GATTAA60
120
180
240
300
360
366
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_001265 [new locus tag: EGJ38_RS06320 ]
- symbol: RicA
- description: RicAFT regulatory complex protein RicA family protein
- length: 121
- theoretical pI: 7.8816
- theoretical MW: 14163.9
- GRAVY: -0.980165
⊟Function[edit | edit source]
- TIGRFAM: hopanoid biosynthesis associated RND transporter like protein HpnN (TIGR03480; HMM-score: 8.1)DNA metabolism DNA replication, recombination, and repair CDK-activating kinase assembly factor MAT1 (TIGR00570; HMM-score: 7)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: no clan defined Com_YlbF; Control of competence regulator ComK, YlbF/YmcA (PF06133; HMM-score: 56.1)and 7 moreMMS21_N; E3 SUMO-protein ligase MMS21, N-terminal domain (PF22326; HMM-score: 12.1)CemA; CemA family (PF03040; HMM-score: 12)Ycf34; Hypothetical chloroplast protein Ycf34 (PF10718; HMM-score: 11.6)Enkurin; Calmodulin-binding (PF13864; HMM-score: 10.9)P-loop_NTPase (CL0023) DUF6079; Family of unknown function (DUF6079) (PF19557; HMM-score: 10.7)no clan defined ABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 10.1)PAS_Fold (CL0183) PAS_13; ERT1/acuK family PAS domain (PF24990; HMM-score: 8.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9802
- Cytoplasmic Membrane Score: 0.0114
- Cell wall & surface Score: 0.0011
- Extracellular Score: 0.0074
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010146
- TAT(Tat/SPI): 0.000457
- LIPO(Sec/SPII): 0.001217
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: MGT2423230 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MYNKDDVLKQADNIANKIKNLDTIKTYQQIEAQIHQNQTIKTKMDMLKKHQKQAVNFQNYGKQNALEQSEHTIQSIEAEINTLPIVEQFQTSQYEANQLLKMFVSTMETRLNDHNKAKHSD
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)