From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0898 [new locus tag: SAUSA300_RS04840 ]
  • pan locus tag?: SAUPAN003164000
  • symbol: spxA
  • pan gene symbol?: spxA
  • synonym:
  • product: transcriptional regulator Spx

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0898 [new locus tag: SAUSA300_RS04840 ]
  • symbol: spxA
  • product: transcriptional regulator Spx
  • replicon: chromosome
  • strand: +
  • coordinates: 986970..987365
  • length: 396
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGTAACATTATTTACTTCACCAAGTTGCACATCTTGCCGTAAAGCGAAAGCATGGTTA
    CAAGAACATGACATTCCGTATACGGAGCGTAATATTTTTTCTGAACATTTAACAATTGAT
    GAAATTAAGCAAATATTAAAAATGACTGAAGACGGTACTGATGAAATCATTTCTACACGT
    TCTAAAACATACCAAAAATTAAATGTTGATATTGATTCACTACCATTACAAGACTTATAT
    TCAATCATTCAAGATAATCCTGGCTTATTACGTCGTCCAATTATTTTAGATAATAAACGA
    CTACAAGTTGGTTATAATGAGGACGAGATTCGACGTTTCTTACCTAGAAAAGTTCGTACG
    TTCCAATTACAAGAAGCACAACGTATGGTTGACTAA
    60
    120
    180
    240
    300
    360
    396


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_0898 [new locus tag: SAUSA300_RS04840 ]
  • symbol: SpxA
  • description: transcriptional regulator Spx
  • length: 131
  • theoretical pI: 6.52593
  • theoretical MW: 15440.6
  • GRAVY: -0.583206

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions transcriptional regulator, Spx/MgsR family (TIGR01617; HMM-score: 123.8)
    and 8 more
    Cellular processes Cellular processes Detoxification arsenate reductase (glutaredoxin) (TIGR00014; EC 1.20.4.1; HMM-score: 46)
    glutaredoxin-like protein, YruB-family (TIGR02196; HMM-score: 33.1)
    glutaredoxin-like protein NrdH (TIGR02194; HMM-score: 31.6)
    Metabolism Energy metabolism Electron transport glutaredoxin 3 (TIGR02181; HMM-score: 21.6)
    glutaredoxin-family domain (TIGR02190; HMM-score: 19.8)
    Unknown function General nitrogenase-associated protein (TIGR01616; HMM-score: 17.9)
    glutaredoxin-like protein (TIGR02200; HMM-score: 17.5)
    Unknown function General redox-active disulfide protein 1 (TIGR00411; HMM-score: 14.1)
  • TheSEED  :
    • Global transcriptional regulator Spx
  • PFAM:
    Thioredoxin (CL0172) ArsC; ArsC family (PF03960; HMM-score: 102.6)
    and 8 more
    Glutaredoxin; Glutaredoxin (PF00462; HMM-score: 38.5)
    GST_N_3; Glutathione S-transferase, N-terminal domain (PF13417; HMM-score: 17.5)
    DUF1223; Protein of unknown function (DUF1223) (PF06764; HMM-score: 17)
    no clan defined Nup54_C; Nup54 C-terminal interacting domain (PF18437; HMM-score: 16.6)
    Thioredoxin (CL0172) Glrx-like; Glutaredoxin-like domain (DUF836) (PF05768; HMM-score: 16.3)
    DHQS (CL0224) AIRC; AIR carboxylase (PF00731; HMM-score: 12.3)
    HeH (CL0306) HeH; HeH/LEM domain (PF12949; HMM-score: 12.2)
    PheT-TilS (CL0383) TilS_C; TilS substrate C-terminal domain (PF11734; HMM-score: 11.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9575
    • Cytoplasmic Membrane Score: 0.0285
    • Cell wall & surface Score: 0.0008
    • Extracellular Score: 0.0133
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.67
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010767
    • TAT(Tat/SPI): 0.000377
    • LIPO(Sec/SPII): 0.003452
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MVTLFTSPSCTSCRKAKAWLQEHDIPYTERNIFSEHLTIDEIKQILKMTEDGTDEIISTRSKTYQKLNVDIDSLPLQDLYSIIQDNPGLLRRPIILDNKRLQVGYNEDEIRRFLPRKVRTFQLQEAQRMVD

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]