From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1002 [new locus tag: SACOL_RS05120 ]
  • pan locus tag?: SAUPAN003164000
  • symbol: spxA
  • pan gene symbol?: spxA
  • synonym:
  • product: transcriptional regulator Spx

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1002 [new locus tag: SACOL_RS05120 ]
  • symbol: spxA
  • product: transcriptional regulator Spx
  • replicon: chromosome
  • strand: +
  • coordinates: 1010442..1010837
  • length: 396
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGTAACATTATTTACTTCACCAAGTTGCACATCTTGCCGTAAAGCGAAAGCATGGTTA
    CAAGAACATGACATTCCGTATACGGAGCGTAATATTTTTTCTGAACATTTAACAATTGAT
    GAAATTAAGCAAATATTAAAAATGACTGAAGACGGTACTGATGAAATCATTTCTACACGT
    TCTAAAACATACCAAAAATTAAATGTTGATATTGATTCACTACCATTACAAGACTTATAT
    TCAATCATTCAAGATAATCCTGGCTTATTACGTCGTCCAATTATTTTAGATAATAAACGA
    CTACAAGTTGGTTATAATGAGGACGAGATTCGACGTTTCTTACCTAGAAAAGTTCGTACG
    TTCCAATTACAAGAAGCACAACGTATGGTTGACTAA
    60
    120
    180
    240
    300
    360
    396

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL1002 [new locus tag: SACOL_RS05120 ]
  • symbol: SpxA
  • description: transcriptional regulator Spx
  • length: 131
  • theoretical pI: 6.52593
  • theoretical MW: 15440.6
  • GRAVY: -0.583206

⊟Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions transcriptional regulator, Spx/MgsR family (TIGR01617; HMM-score: 123.8)
    and 8 more
    Cellular processes Cellular processes Detoxification arsenate reductase (glutaredoxin) (TIGR00014; EC 1.20.4.1; HMM-score: 46)
    glutaredoxin-like protein, YruB-family (TIGR02196; HMM-score: 33.1)
    glutaredoxin-like protein NrdH (TIGR02194; HMM-score: 31.6)
    Metabolism Energy metabolism Electron transport glutaredoxin 3 (TIGR02181; HMM-score: 21.6)
    glutaredoxin-family domain (TIGR02190; HMM-score: 19.8)
    Unknown function General nitrogenase-associated protein (TIGR01616; HMM-score: 17.9)
    glutaredoxin-like protein (TIGR02200; HMM-score: 17.5)
    Unknown function General redox-active disulfide protein 1 (TIGR00411; HMM-score: 14.1)
  • TheSEED  :
    • Global transcriptional regulator Spx
  • PFAM:
    Thioredoxin (CL0172) ArsC; ArsC family (PF03960; HMM-score: 83.2)
    and 6 more
    Glutaredoxin; Glutaredoxin (PF00462; HMM-score: 37.1)
    DUF1223; Protein of unknown function (DUF1223) (PF06764; HMM-score: 17.7)
    DUF836; Glutaredoxin-like domain (DUF836) (PF05768; HMM-score: 15.1)
    GST_N_3; Glutathione S-transferase, N-terminal domain (PF13417; HMM-score: 14.6)
    no clan defined AIRC; AIR carboxylase (PF00731; HMM-score: 12.2)
    PheT-TilS (CL0383) TilS_C; TilS substrate C-terminal domain (PF11734; HMM-score: 11.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.67
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010767
    • TAT(Tat/SPI): 0.000377
    • LIPO(Sec/SPII): 0.003452
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MVTLFTSPSCTSCRKAKAWLQEHDIPYTERNIFSEHLTIDEIKQILKMTEDGTDEIISTRSKTYQKLNVDIDSLPLQDLYSIIQDNPGLLRRPIILDNKRLQVGYNEDEIRRFLPRKVRTFQLQEAQRMVD

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Signal peptide containing [1] [2] [3]
  • quantitative data / protein copy number per cell: 63 [4]
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Suzanne E Dale, Amanda Doherty-Kirby, Gilles Lajoie, David E Heinrichs
Role of siderophore biosynthesis in virulence of Staphylococcus aureus: identification and characterization of genes involved in production of a siderophore.
Infect Immun: 2004, 72(1);29-37
[PubMed:14688077] [WorldCat.org] [DOI] (P p)

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SACOL1002&oldid=83414"