Jump to navigation
Jump to search
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_0867 [new locus tag: NWMN_RS04870 ]
- pan locus tag?: SAUPAN003164000
- symbol: spxA
- pan gene symbol?: spxA
- synonym:
- product: transcriptional regulator Spx
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_0867 [new locus tag: NWMN_RS04870 ]
- symbol: spxA
- product: transcriptional regulator Spx
- replicon: chromosome
- strand: +
- coordinates: 963616..964011
- length: 396
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 5332568 NCBI
- RefSeq: YP_001331901 NCBI
- BioCyc:
- MicrobesOnline: 3706416 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGGTAACATTATTTACTTCACCAAGTTGCACATCTTGCCGTAAAGCGAAAGCATGGTTA
CAAGAACATGACATTCCGTATACGGAGCGTAATATTTTTTCTGAACATTTAACAATTGAT
GAAATTAAGCAAATATTAAAAATGACTGAAGACGGTACTGATGAAATCATTTCTACACGT
TCTAAAACATACCAAAAATTAAATGTTGATATTGATTCACTACCATTACAAGACTTATAT
TCAATCATTCAAGATAATCCTGGCTTATTACGTCGTCCAATTATTTTAGATAATAAACGA
CTACAAGTTGGTTATAATGAGGACGAGATTCGACGTTTCTTACCTAGAAAAGTTCGTACG
TTCCAATTACAAGAAGCACAACGTATGGTTGACTAA60
120
180
240
300
360
396
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_0867 [new locus tag: NWMN_RS04870 ]
- symbol: SpxA
- description: transcriptional regulator Spx
- length: 131
- theoretical pI: 6.52593
- theoretical MW: 15440.6
- GRAVY: -0.583206
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions transcriptional regulator, Spx/MgsR family (TIGR01617; HMM-score: 123.8)and 8 moreCellular processes Detoxification arsenate reductase (glutaredoxin) (TIGR00014; EC 1.20.4.1; HMM-score: 46)glutaredoxin-like protein, YruB-family (TIGR02196; HMM-score: 33.1)glutaredoxin-like protein NrdH (TIGR02194; HMM-score: 31.6)Energy metabolism Electron transport glutaredoxin 3 (TIGR02181; HMM-score: 21.6)glutaredoxin-family domain (TIGR02190; HMM-score: 19.8)Unknown function General nitrogenase-associated protein (TIGR01616; HMM-score: 17.9)glutaredoxin-like protein (TIGR02200; HMM-score: 17.5)Unknown function General redox-active disulfide protein 1 (TIGR00411; HMM-score: 14.1)
- TheSEED :
- Global transcriptional regulator Spx
- PFAM: Thioredoxin (CL0172) ArsC; ArsC family (PF03960; HMM-score: 102.6)and 8 moreGlutaredoxin; Glutaredoxin (PF00462; HMM-score: 38.5)GST_N_3; Glutathione S-transferase, N-terminal domain (PF13417; HMM-score: 17.5)DUF1223; Protein of unknown function (DUF1223) (PF06764; HMM-score: 17)no clan defined Nup54_C; Nup54 C-terminal interacting domain (PF18437; HMM-score: 16.6)Thioredoxin (CL0172) Glrx-like; Glutaredoxin-like domain (DUF836) (PF05768; HMM-score: 16.3)DHQS (CL0224) AIRC; AIR carboxylase (PF00731; HMM-score: 12.3)HeH (CL0306) HeH; HeH/LEM domain (PF12949; HMM-score: 12.2)PheT-TilS (CL0383) TilS_C; TilS substrate C-terminal domain (PF11734; HMM-score: 11.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9575
- Cytoplasmic Membrane Score: 0.0285
- Cell wall & surface Score: 0.0008
- Extracellular Score: 0.0133
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 0.67
- Signal peptide possibility: -0.5
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010767
- TAT(Tat/SPI): 0.000377
- LIPO(Sec/SPII): 0.003452
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVTLFTSPSCTSCRKAKAWLQEHDIPYTERNIFSEHLTIDEIKQILKMTEDGTDEIISTRSKTYQKLNVDIDSLPLQDLYSIIQDNPGLLRRPIILDNKRLQVGYNEDEIRRFLPRKVRTFQLQEAQRMVD
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.