From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2436 [new locus tag: SACOL_RS12785 ]
  • pan locus tag?: SAUPAN005981000
  • symbol: SACOL2436
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2436 [new locus tag: SACOL_RS12785 ]
  • symbol: SACOL2436
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2494043..2494702
  • length: 660
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAAGAACTGATAAATACCGTGATTCATATCAATACGACAATCAAAACCAAAATCAT
    CGTCGTCAATCTGAAGACGCATCGTATAGACAACAATATGCTAAAGGCGATCCTGAAGAA
    CACCCGGAACGATACTATAATGGTAGAGATTATCGAAGAGAACAAATTCTTGAAGAAGAA
    AACGAGAAATCCCGCCGTTCAAAAAAATGGTTATATATCATTATTGCCATTCTCTTAATT
    ATTGTCGCTATTTTTGTCACACGCGCCTTACTTAACAATGATAGCGATAAAGTTAGTAAT
    GACCCTAAAGTCTCTCAAAATTATAAAAAACAAGTTGAAAATCAAGACGGCCAAATTAAC
    CAGCAAGTAGATAATGCTAAAGAAAATATTAAAAACAACCAAAAAACTGATGACATTATT
    AAAAATTTACAAAATCAAATCGACAACTTGAAGCAGCAAGAACAAAACAAAGCTGATTCT
    AAGCTAACTCAATTTTATCAAGACCAAATCAACAAATTGACAGAGGCAAATAATGCACTT
    AAAAACAATGCAAGCCAAGGTAAAATTGAAAGCATGTTAAATGATATTAATACAAAATTC
    GACAGTATTAAATCTAAATTAGAAAGCTTATTTAAAGATGACAATGGTGGCGCTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL2436 [new locus tag: SACOL_RS12785 ]
  • symbol: SACOL2436
  • description: hypothetical protein
  • length: 219
  • theoretical pI: 8.61585
  • theoretical MW: 25799.2
  • GRAVY: -1.38402

⊟Function[edit | edit source]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 15.1)
    Genetic information processing Protein fate Protein folding and stabilization cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Energy metabolism Electron transport cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 13.7)
    and 11 more
    Cellular processes Cellular processes Pathogenesis type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Cellular processes Cellular processes Toxin production and resistance thiopeptide-type bacteriocin biosynthesis domain (TIGR03891; HMM-score: 11.1)
    Hypothetical proteins Conserved TIGR00366 family protein (TIGR00366; HMM-score: 10.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-galactonate transporter (TIGR00893; HMM-score: 10)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10)
    conjugal transfer/type IV secretion protein DotA/TraY (TIGR04346; HMM-score: 9.1)
    phage lysis regulatory protein, LysB family (TIGR03495; HMM-score: 5.6)
    two transmembrane protein (TIGR04527; HMM-score: 4.7)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
  • TheSEED  :
    • FIG01107902: hypothetical protein
  • PFAM:
    no clan defined DUF4094; Domain of unknown function (DUF4094) (PF13334; HMM-score: 19.4)
    GlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 18.9)
    FRB_dom; FKBP12-rapamycin binding domain (PF08771; HMM-score: 18.5)
    Med9; RNA polymerase II transcription mediator complex subunit 9 (PF07544; HMM-score: 17.1)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 16.9)
    no clan defined EntA_Immun; Enterocin A Immunity (PF08951; HMM-score: 16.8)
    SNARE-fusion (CL0445) SNARE; SNARE domain (PF05739; HMM-score: 16.2)
    no clan defined RIG-I_C; RIG-I receptor C-terminal domain (PF18119; HMM-score: 16)
    and 25 more
    Cep57_MT_bd; Centrosome microtubule-binding domain of Cep57 (PF06657; HMM-score: 13.9)
    DUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 13.7)
    INV_N; Beta-fructofuranosidase, N-terminal domain (PF11837; HMM-score: 13.1)
    SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 13)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 12.9)
    ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 12.7)
    PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 12.5)
    ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 12.3)
    Tbcl_zf (CL0839) DUF2116; Probable treble clef (PF09889; HMM-score: 12.3)
    MFS (CL0015) MFS_Mycoplasma; Mycoplasma MFS transporter (PF07672; HMM-score: 12.1)
    no clan defined DUF6480; Family of unknown function (DUF6480) (PF20088; HMM-score: 11.7)
    IT (CL0182) SCFA_trans; Short chain fatty acid transporter (PF02667; HMM-score: 10.7)
    no clan defined Piezo_TM1-24; Piezo TM1-24 (PF24871; HMM-score: 10.2)
    T2SSF; Type II secretion system (T2SS), protein F (PF00482; HMM-score: 9.5)
    HEF_HK; HEF_HK domain (PF19191; HMM-score: 9.1)
    YtxH; YtxH-like protein (PF12732; HMM-score: 9)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 8.8)
    Saposin_like (CL0707) SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 8.8)
    no clan defined DUF6779; Domain of unknown function (DUF6779) (PF20570; HMM-score: 8.3)
    LprI; Lysozyme inhibitor LprI (PF07007; HMM-score: 7.9)
    GT-B (CL0113) FUT8_N_cat; Alpha-(1,6)-fucosyltransferase N- and catalytic domains (PF19745; HMM-score: 7.4)
    MFS (CL0015) SLC52_ribofla_tr; Solute carrier family 52, riboflavin transporter (PF06237; HMM-score: 7.3)
    no clan defined DUF2408; Protein of unknown function (DUF2408) (PF10303; HMM-score: 7.2)
    TSPAN_4TM-like (CL0347) Tetraspanin; Tetraspanin family (PF00335; HMM-score: 6.4)
    no clan defined AI-2E_transport; AI-2E family transporter (PF01594; HMM-score: 5.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9451
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0547
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.023157
    • TAT(Tat/SPI): 0.00401
    • LIPO(Sec/SPII): 0.008892
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKRTDKYRDSYQYDNQNQNHRRQSEDASYRQQYAKGDPEEHPERYYNGRDYRREQILEEENEKSRRSKKWLYIIIAILLIIVAIFVTRALLNNDSDKVSNDPKVSQNYKKQVENQDGQINQQVDNAKENIKNNQKTDDIIKNLQNQIDNLKQQEQNKADSKLTQFYQDQINKLTEANNALKNNASQGKIESMLNDINTKFDSIKSKLESLFKDDNGGAN

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Integral membrane [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 111 [5]
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [6] [7]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  7. ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]