From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02724
  • pan locus tag?: SAUPAN005981000
  • symbol: SAOUHSC_02724
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02724
  • symbol: SAOUHSC_02724
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2504707..2505366
  • length: 660
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAAGAACTGATAAATACCGTGATTCATATCAATACGACAATCAAAACCAAAATCAT
    CGTCGTCAATCTGAAGACGCATCGTATAGACAACAATATGCTAAAGGCGATCCTGAAGAA
    CACCCGGAACGATACTATAATGGTAGAGATTATCGAAGAGAACAAATTCTTGAAGAAGAA
    AACGAGAAATCCCGCCGTTCAAAAAAATGGTTATATATCATTATTGCCATTCTCTTAATT
    ATTGTCGCTATTTTTGTCACACGCGCCTTACTTAACAATGATAGCGATAAAGTTAGTAAT
    GACCCTAAAGTCTCTCAAAATTATAAAAAACAAGTTGAAAATCAAGACGGCCAAATTAAC
    CAGCAAGTAGATAATGCTAAAGAAAATATTAAAAACAACCAAAAAACTGATGACATTATT
    AAAAATTTACAAAATCAAATCGACAACTTGAAGCAGCAAGAACAAAACAAAGCTGATTCT
    AAGCTAACTCAATTTTATCAAGACCAAATCAACAAATTGACAGAGGCAAATAATGCACTT
    AAAAACAATGCAAGCCAAGGTAAAATTGAAAGCATGTTAAATGATATTAATACAAAATTC
    GACAGTATTAAATCTAAATTAGAAAGCTTATTTAAAGATGACAATGGTGGCGCTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_02724
  • symbol: SAOUHSC_02724
  • description: hypothetical protein
  • length: 219
  • theoretical pI: 8.61585
  • theoretical MW: 25799.2
  • GRAVY: -1.38402

⊟Function[edit | edit source]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 15.1)
    Genetic information processing Protein fate Protein folding and stabilization cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Energy metabolism Electron transport cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 13.7)
    and 11 more
    Cellular processes Cellular processes Pathogenesis type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Cellular processes Cellular processes Toxin production and resistance thiopeptide-type bacteriocin biosynthesis domain (TIGR03891; HMM-score: 11.1)
    Hypothetical proteins Conserved TIGR00366 family protein (TIGR00366; HMM-score: 10.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-galactonate transporter (TIGR00893; HMM-score: 10)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10)
    conjugal transfer/type IV secretion protein DotA/TraY (TIGR04346; HMM-score: 9.1)
    phage lysis regulatory protein, LysB family (TIGR03495; HMM-score: 5.6)
    two transmembrane protein (TIGR04527; HMM-score: 4.7)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
  • TheSEED  :
    • FIG01107902: hypothetical protein
  • PFAM:
    no clan defined DUF4094; Domain of unknown function (DUF4094) (PF13334; HMM-score: 19.4)
    GlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 18.9)
    FRB_dom; FKBP12-rapamycin binding domain (PF08771; HMM-score: 18.5)
    Med9; RNA polymerase II transcription mediator complex subunit 9 (PF07544; HMM-score: 17.1)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 16.9)
    no clan defined EntA_Immun; Enterocin A Immunity (PF08951; HMM-score: 16.8)
    SNARE-fusion (CL0445) SNARE; SNARE domain (PF05739; HMM-score: 16.2)
    no clan defined RIG-I_C; RIG-I receptor C-terminal domain (PF18119; HMM-score: 16)
    and 25 more
    Cep57_MT_bd; Centrosome microtubule-binding domain of Cep57 (PF06657; HMM-score: 13.9)
    DUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 13.7)
    INV_N; Beta-fructofuranosidase, N-terminal domain (PF11837; HMM-score: 13.1)
    SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 13)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 12.9)
    ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 12.7)
    PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 12.5)
    ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 12.3)
    Tbcl_zf (CL0839) DUF2116; Probable treble clef (PF09889; HMM-score: 12.3)
    MFS (CL0015) MFS_Mycoplasma; Mycoplasma MFS transporter (PF07672; HMM-score: 12.1)
    no clan defined DUF6480; Family of unknown function (DUF6480) (PF20088; HMM-score: 11.7)
    IT (CL0182) SCFA_trans; Short chain fatty acid transporter (PF02667; HMM-score: 10.7)
    no clan defined Piezo_TM1-24; Piezo TM1-24 (PF24871; HMM-score: 10.2)
    T2SSF; Type II secretion system (T2SS), protein F (PF00482; HMM-score: 9.5)
    HEF_HK; HEF_HK domain (PF19191; HMM-score: 9.1)
    YtxH; YtxH-like protein (PF12732; HMM-score: 9)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 8.8)
    Saposin_like (CL0707) SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 8.8)
    no clan defined DUF6779; Domain of unknown function (DUF6779) (PF20570; HMM-score: 8.3)
    LprI; Lysozyme inhibitor LprI (PF07007; HMM-score: 7.9)
    GT-B (CL0113) FUT8_N_cat; Alpha-(1,6)-fucosyltransferase N- and catalytic domains (PF19745; HMM-score: 7.4)
    MFS (CL0015) SLC52_ribofla_tr; Solute carrier family 52, riboflavin transporter (PF06237; HMM-score: 7.3)
    no clan defined DUF2408; Protein of unknown function (DUF2408) (PF10303; HMM-score: 7.2)
    TSPAN_4TM-like (CL0347) Tetraspanin; Tetraspanin family (PF00335; HMM-score: 6.4)
    no clan defined AI-2E_transport; AI-2E family transporter (PF01594; HMM-score: 5.8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9451
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0547
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.023157
    • TAT(Tat/SPI): 0.00401
    • LIPO(Sec/SPII): 0.008892
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKRTDKYRDSYQYDNQNQNHRRQSEDASYRQQYAKGDPEEHPERYYNGRDYRREQILEEENEKSRRSKKWLYIIIAILLIIVAIFVTRALLNNDSDKVSNDPKVSQNYKKQVENQDGQINQQVDNAKENIKNNQKTDDIIKNLQNQIDNLKQQEQNKADSKLTQFYQDQINKLTEANNALKNNASQGKIESMLNDINTKFDSIKSKLESLFKDDNGGAN

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: VraR* (activation) regulon
    VraR*(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [3] [4]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  4. ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)
  5. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]