From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2211 [new locus tag: SACOL_RS11640 ]
  • pan locus tag?: SAUPAN005672000
  • symbol: cbiO
  • pan gene symbol?: cbiO1
  • synonym: ecfA1
  • product: cobalt transporter ATP-binding subunit

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2211 [new locus tag: SACOL_RS11640 ]
  • symbol: cbiO
  • product: cobalt transporter ATP-binding subunit
  • replicon: chromosome
  • strand: -
  • coordinates: 2292224..2293033
  • length: 810
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    GTGGAGGATAAGAATTCAGTTATTGTATTTAAAAATGTTTCATTTCAATATCAAAGTGAT
    GCATCCTTCACATTGAAAGATGTTTCTTTTAATATACCTAAAGGTCAGTGGACATCTATT
    GTTGGTCATAACGGTTCTGGAAAATCTACAATTGCCAAGTTAATGATTGGCATAGAGAAA
    GTTAAATCTGGAGAAATTTTTTATAATAATCAAGCTATAACTGATGATAATTTTGAAAAG
    TTAAGAAAAGACATAGGAATTGTATTTCAGAATCCGGATAATCAATTTGTTGGTTCAATT
    GTAAAATACGATGTGGCATTTGGACTCGAAAATCATGCGGTTCCATATGACGAAATGCAT
    AGAAGAGTCAGCGAAGCACTTAAACAAGTTGATATGTTAGAACGTGCAGATTATGAACCT
    AATGCATTATCGGGGGGACAGAAGCAGCGTGTGGCTATAGCAAGTGTATTAGCACTTAAC
    CCCTCTGTCATTATATTAGATGAGGCGACTTCTATGTTAGATCCTGATGCACGTCAAAAT
    TTATTGGATTTAGTGAGAAAAGTTAAATCAGAACATAATATTACAATCATTTCTATTACG
    CATGATTTATCTGAGGCGATGGAAGCAGATCATGTTATCGTTATGAATAAAGGGACTGTC
    TATAAAGAAGGCACAGCGACTGAAATTTTCGACAATGCAGAAGAGTTAACAAGAATAGGT
    CTAGATTTGCCATTCCCAATCAAAATAAATCAAATGCTGGGACACCAAACATCATTCTTA
    ACTTATGAAGGGCTGGTGGATCAACTATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    810


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL2211 [new locus tag: SACOL_RS11640 ]
  • symbol: CbiO
  • description: cobalt transporter ATP-binding subunit
  • length: 269
  • theoretical pI: 4.8143
  • theoretical MW: 30049.9
  • GRAVY: -0.227509

⊟Function[edit | edit source]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 346.4)
    and 82 more
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 244.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 170.7)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 166.6)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 159.8)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 154.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 154.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 152.8)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 152.4)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 150.3)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 149.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 146.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 145.7)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 144.4)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 140.4)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 137.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 137.3)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 136.7)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 136.5)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 135.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 135.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 133.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 133.1)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 133.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 129.9)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.8)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.8)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 127.5)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 126.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 122.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 121.9)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 118.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 118.3)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 118.3)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 118.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 116.2)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 114.8)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 114.3)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 114.3)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 113.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 112.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 112)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 111)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 106.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104.3)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104.3)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 98)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 95.8)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 95.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 95.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 93.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 93.4)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 92.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81.5)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81.5)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 81.3)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 80.3)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 80.3)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 80)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 78.3)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 74.8)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 72.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.2)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.2)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.5)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 65.8)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 63.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 52.3)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 43.6)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 43)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 42.5)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 25.5)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 25.5)
    rad50 (TIGR00606; HMM-score: 15.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 15.3)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 14.4)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 13.5)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 13.3)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 13.3)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 12)
    Cellular processes Cellular processes Toxin production and resistance prevent-host-death family protein (TIGR01552; HMM-score: 11.2)
    Genetic information processing Mobile and extrachromosomal element functions Other prevent-host-death family protein (TIGR01552; HMM-score: 11.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 9.2)
  • TheSEED  :
    • ATPase component of general energizing module of ECF transporters
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  ATPase component of general energizing module of ECF transporters
    and 1 more
    Membrane Transport Membrane Transport - no subcategory ECF class transporters  ATPase component of general energizing module of ECF transporters
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.7)
    and 23 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 58.8)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 30.6)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 21)
    AAA_22; AAA domain (PF13401; HMM-score: 20.4)
    AAA_23; AAA domain (PF13476; HMM-score: 20.2)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 19.5)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 19.3)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.6)
    AAA_33; AAA domain (PF13671; HMM-score: 16.9)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 16.6)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 16.4)
    KdpD; Osmosensitive K+ channel His kinase sensor domain (PF02702; HMM-score: 15.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.1)
    AAA_25; AAA domain (PF13481; HMM-score: 15.1)
    RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 13.8)
    ATPase; KaiC (PF06745; HMM-score: 13.6)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 13.5)
    AAA_14; AAA domain (PF13173; HMM-score: 13.2)
    AAA_13; AAA domain (PF13166; HMM-score: 12.5)
    AAA_17; AAA domain (PF13207; HMM-score: 12.5)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 12.2)
    TIM_barrel (CL0036) Spherulin4; Spherulation-specific family 4 (PF12138; HMM-score: 12.1)
    P-loop_NTPase (CL0023) AAA_18; AAA domain (PF13238; HMM-score: 11.7)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.0707
    • Cytoplasmic Membrane Score: 0.9216
    • Cell wall & surface Score: 0.0004
    • Extracellular Score: 0.0073
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00978
    • TAT(Tat/SPI): 0.000356
    • LIPO(Sec/SPII): 0.002372
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MEDKNSVIVFKNVSFQYQSDASFTLKDVSFNIPKGQWTSIVGHNGSGKSTIAKLMIGIEKVKSGEIFYNNQAITDDNFEKLRKDIGIVFQNPDNQFVGSIVKYDVAFGLENHAVPYDEMHRRVSEALKQVDMLERADYEPNALSGGQKQRVAIASVLALNPSVIILDEATSMLDPDARQNLLDLVRKVKSEHNITIISITHDLSEAMEADHVIVMNKGTVYKEGTATEIFDNAEELTRIGLDLPFPIKINQMLGHQTSFLTYEGLVDQL

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2]
  • quantitative data / protein copy number per cell: 27 [3]
  • interaction partners:
    SACOL1741(icd)isocitrate dehydrogenase  [4] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [4] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [4] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [4] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [4] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [4] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [4] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [4] (data from MRSA252)
    SACOL2525ABC transporter ATP-binding protein  [4] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  4. ↑ 4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]