From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1445 [new locus tag: SACOL_RS07370 ]
  • pan locus tag?: SAUPAN003827000
  • symbol: SACOL1445
  • pan gene symbol?:
  • synonym:
  • product: CbbQ/NirQ/NorQ/GpvN family protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1445 [new locus tag: SACOL_RS07370 ]
  • symbol: SACOL1445
  • product: CbbQ/NirQ/NorQ/GpvN family protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1457098..1457889
  • length: 792
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGCACTAAAACATTATAAGAATTCAGATTCAACAGTTTTCAATGATGCGAAGGCATTA
    TTTGATTTAAATAAAAATATTTTACTTAAAGGTCCAACAGGTTCAGGGAAAACAAAGTTG
    GCAGAAACATTAAGTGAAGTTGTTGATACACCCATGCATCAAGTCAATTGTTCTGTTGAT
    TTAGATACAGAAAGCTTATTAGGCTTTAAAACAATTAAAACAAATGCGGAAGGTCAACAA
    GAAATTGTCTTTGTAGATGGTCCAGTTATTAAAGCTATGAAAGAGGGGCATATTTTATAT
    ATTGATGAAATAAATATGGCTAAACCTGAAACATTGCCTGTATTAAATGGGGTCTTAGAT
    TATCGTCGTCAAATTACGAATCCATACACTGGTGAAGTAATCAAAGCTGTACCAGGATTT
    AACGTTATAGCAGCGATAAATGAAGGTTATGTTGGTACTTTGCCAATGAATGAAGCACTA
    AAAAATCGCTTTGTTGTTATTCACGTTGATTATATTGATGGGGACATTTTAAAAAATGTG
    ATTAAAGAGCAAAGTTTATTACAAGATGATAAACAAATCGAACAAATTATTAAGTTTAAT
    GAAGATTTACGTACTATGTCTAAGCAGGGACAAATTTCTGAAGAAGCCGCTAGTATCCGT
    GCATTATTAGACTTGTGTGATTTAATCACTGTAATGCCAGTTGAACGTGCAATTAAACGT
    ACAATTATTGATAAATTGGAAGATGAACGTGAACAACAAGCAATATATAATGCTGTAGAA
    CTAAACTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    792


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1445 [new locus tag: SACOL_RS07370 ]
  • symbol: SACOL1445
  • description: CbbQ/NirQ/NorQ/GpvN family protein
  • length: 263
  • theoretical pI: 4.68695
  • theoretical MW: 29448.6
  • GRAVY: -0.186312

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 75.1)
    and 11 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobS subunit (TIGR01650; EC 6.6.1.2; HMM-score: 34.8)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 27.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium chelatase ATPase subunit D (TIGR02031; EC 6.6.1.1; HMM-score: 20.5)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 18.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 14.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 14.1)
    Cellular processes Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 13.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 13.3)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 12.2)
  • TheSEED  :
    • Nitric oxide reductase activation protein NorQ
    Stress Response Stress Response - no subcategory Flavohaemoglobin  Nitric oxide reductase activation protein NorQ
  • PFAM:
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 99.7)
    and 30 more
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 45.2)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 27.5)
    bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 26)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 23.4)
    AAA_lid (CL0671) CbbQ_C; CbbQ/NirQ/NorQ C-terminal (PF08406; HMM-score: 23.3)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 22.7)
    AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 21.1)
    AAA_14; AAA domain (PF13173; HMM-score: 20.9)
    RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 20.6)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 20.6)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 19.3)
    AAA_6; Hydrolytic ATP binding site of dynein motor region (PF12774; HMM-score: 17.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.3)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 16.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.3)
    AAA_18; AAA domain (PF13238; HMM-score: 16.3)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.6)
    AAA_22; AAA domain (PF13401; HMM-score: 15.3)
    ABC_tran; ABC transporter (PF00005; HMM-score: 14.9)
    CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 14.4)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 14.2)
    AAA_PrkA; PrkA AAA domain (PF08298; HMM-score: 13.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.5)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 13.2)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.2)
    AAA_17; AAA domain (PF13207; HMM-score: 13.2)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.1)
    AAA_30; AAA domain (PF13604; HMM-score: 12.5)
    AAA_lid (CL0671) AAA_lid_7; Midasin AAA lid domain (PF17867; HMM-score: 12.5)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 12.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9898
    • Cytoplasmic Membrane Score: 0.0008
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0094
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006207
    • TAT(Tat/SPI): 0.000694
    • LIPO(Sec/SPII): 0.000454
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MALKHYKNSDSTVFNDAKALFDLNKNILLKGPTGSGKTKLAETLSEVVDTPMHQVNCSVDLDTESLLGFKTIKTNAEGQQEIVFVDGPVIKAMKEGHILYIDEINMAKPETLPVLNGVLDYRRQITNPYTGEVIKAVPGFNVIAAINEGYVGTLPMNEALKNRFVVIHVDYIDGDILKNVIKEQSLLQDDKQIEQIIKFNEDLRTMSKQGQISEEAASIRALLDLCDLITVMPVERAIKRTIIDKLEDEREQQAIYNAVELNF

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 866 [5]
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 30.95 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]