Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1445 [new locus tag: SACOL_RS07370 ]
- pan locus tag?: SAUPAN003827000
- symbol: SACOL1445
- pan gene symbol?: —
- synonym:
- product: CbbQ/NirQ/NorQ/GpvN family protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1445 [new locus tag: SACOL_RS07370 ]
- symbol: SACOL1445
- product: CbbQ/NirQ/NorQ/GpvN family protein
- replicon: chromosome
- strand: -
- coordinates: 1457098..1457889
- length: 792
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238280 NCBI
- RefSeq: YP_186297 NCBI
- BioCyc: see SACOL_RS07370
- MicrobesOnline: 912903 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781ATGGCACTAAAACATTATAAGAATTCAGATTCAACAGTTTTCAATGATGCGAAGGCATTA
TTTGATTTAAATAAAAATATTTTACTTAAAGGTCCAACAGGTTCAGGGAAAACAAAGTTG
GCAGAAACATTAAGTGAAGTTGTTGATACACCCATGCATCAAGTCAATTGTTCTGTTGAT
TTAGATACAGAAAGCTTATTAGGCTTTAAAACAATTAAAACAAATGCGGAAGGTCAACAA
GAAATTGTCTTTGTAGATGGTCCAGTTATTAAAGCTATGAAAGAGGGGCATATTTTATAT
ATTGATGAAATAAATATGGCTAAACCTGAAACATTGCCTGTATTAAATGGGGTCTTAGAT
TATCGTCGTCAAATTACGAATCCATACACTGGTGAAGTAATCAAAGCTGTACCAGGATTT
AACGTTATAGCAGCGATAAATGAAGGTTATGTTGGTACTTTGCCAATGAATGAAGCACTA
AAAAATCGCTTTGTTGTTATTCACGTTGATTATATTGATGGGGACATTTTAAAAAATGTG
ATTAAAGAGCAAAGTTTATTACAAGATGATAAACAAATCGAACAAATTATTAAGTTTAAT
GAAGATTTACGTACTATGTCTAAGCAGGGACAAATTTCTGAAGAAGCCGCTAGTATCCGT
GCATTATTAGACTTGTGTGATTTAATCACTGTAATGCCAGTTGAACGTGCAATTAAACGT
ACAATTATTGATAAATTGGAAGATGAACGTGAACAACAAGCAATATATAATGCTGTAGAA
CTAAACTTTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
792
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1445 [new locus tag: SACOL_RS07370 ]
- symbol: SACOL1445
- description: CbbQ/NirQ/NorQ/GpvN family protein
- length: 263
- theoretical pI: 4.68695
- theoretical MW: 29448.6
- GRAVY: -0.186312
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 75.1)and 11 moreBiosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobS subunit (TIGR01650; EC 6.6.1.2; HMM-score: 34.8)Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 27.8)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium chelatase ATPase subunit D (TIGR02031; EC 6.6.1.1; HMM-score: 20.5)Protein fate Protein folding and stabilization ATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 18.7)Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 14.3)DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 14.1)Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 13.6)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 13.3)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 12.2)
- TheSEED :
- Nitric oxide reductase activation protein NorQ
- PFAM: P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 99.7)and 30 moreAAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 45.2)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 27.5)bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 26)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 23.4)AAA_lid (CL0671) CbbQ_C; CbbQ/NirQ/NorQ C-terminal (PF08406; HMM-score: 23.3)P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 22.7)AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 21.1)AAA_14; AAA domain (PF13173; HMM-score: 20.9)RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 20.6)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 20.6)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 19.3)AAA_6; Hydrolytic ATP binding site of dynein motor region (PF12774; HMM-score: 17.3)AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.3)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 16.5)IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.3)AAA_18; AAA domain (PF13238; HMM-score: 16.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.6)AAA_22; AAA domain (PF13401; HMM-score: 15.3)ABC_tran; ABC transporter (PF00005; HMM-score: 14.9)CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 14.4)ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 14.2)AAA_PrkA; PrkA AAA domain (PF08298; HMM-score: 13.9)ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.5)DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 13.2)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.2)AAA_17; AAA domain (PF13207; HMM-score: 13.2)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.1)AAA_30; AAA domain (PF13604; HMM-score: 12.5)AAA_lid (CL0671) AAA_lid_7; Midasin AAA lid domain (PF17867; HMM-score: 12.5)P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 12.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9898
- Cytoplasmic Membrane Score: 0.0008
- Cell wall & surface Score: 0
- Extracellular Score: 0.0094
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006207
- TAT(Tat/SPI): 0.000694
- LIPO(Sec/SPII): 0.000454
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MALKHYKNSDSTVFNDAKALFDLNKNILLKGPTGSGKTKLAETLSEVVDTPMHQVNCSVDLDTESLLGFKTIKTNAEGQQEIVFVDGPVIKAMKEGHILYIDEINMAKPETLPVLNGVLDYRRQITNPYTGEVIKAVPGFNVIAAINEGYVGTLPMNEALKNRFVVIHVDYIDGDILKNVIKEQSLLQDDKQIEQIIKFNEDLRTMSKQGQISEEAASIRALLDLCDLITVMPVERAIKRTIIDKLEDEREQQAIYNAVELNF
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: 30.95 h [6]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)