From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01413
  • pan locus tag?: SAUPAN003827000
  • symbol: SAOUHSC_01413
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01413
  • symbol: SAOUHSC_01413
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1353324..1354115
  • length: 792
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGCACTAAAACATTATAAGAATTCAGATTCAACAGTTTTCAATGATGCGAAGGCATTA
    TTTGATTTAAATAAAAATATTTTACTTAAAGGTCCAACAGGTTCAGGGAAAACAAAGTTG
    GCAGAAACATTAAGTGAAGTTGTTGATACACCCATGCATCAAGTCAATTGTTCTGTTGAT
    TTAGATACAGAAAGCTTATTAGGCTTTAAAACAATTAAAACAAATGCGGAAGGTCAACAA
    GAAATTGTCTTTGTAGATGGTCCAGTTATTAAAGCTATGAAAGAGGGGCATATTTTATAT
    ATTGATGAAATAAATATGGCTAAACCTGAAACATTGCCTGTATTAAATGGGGTCTTAGAT
    TATCGTCGTCAAATTACGAATCCATACACTGGTGAAGTAATCAAAGCTGTACCAGGATTT
    AACGTTATAGCAGCGATAAATGAAGGTTATGTTGGTACTTTGCCAATGAATGAAGCACTA
    AAAAATCGCTTTGTTGTTATTCACGTTGATTATATTGATGGGGACATTTTAAAAAATGTG
    ATTAAAGAGCAAAGTTTATTACAAGATGATAAACAAATCGAACAAATTATTAAGTTTAAT
    GAAGATTTACGTACTATGTCTAAGCAGGGACAAATTTCTGAAGAAGCCGCTAGTATCCGT
    GCATTATTAGACTTGTGTGATTTAATCACTGTAATGCCAGTTGAACGTGCAATTAAACGT
    ACAATTATTGATAAATTGGAAGATGAACGTGAACAACAAGCAATATATAATGCTGTAGAA
    CTAAACTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    792


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_01413
  • symbol: SAOUHSC_01413
  • description: hypothetical protein
  • length: 263
  • theoretical pI: 4.68695
  • theoretical MW: 29448.6
  • GRAVY: -0.186312

⊟Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 75.1)
    and 11 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobS subunit (TIGR01650; EC 6.6.1.2; HMM-score: 34.8)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 27.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium chelatase ATPase subunit D (TIGR02031; EC 6.6.1.1; HMM-score: 20.5)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 18.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 14.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 14.1)
    Cellular processes Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 13.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 13.3)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 12.2)
  • TheSEED  :
    • Nitric oxide reductase activation protein NorQ
    Stress Response Stress Response - no subcategory Flavohaemoglobin  Nitric oxide reductase activation protein NorQ
  • PFAM:
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 99.7)
    and 30 more
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 45.2)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 27.5)
    bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 26)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 23.4)
    AAA_lid (CL0671) CbbQ_C; CbbQ/NirQ/NorQ C-terminal (PF08406; HMM-score: 23.3)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 22.7)
    AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 21.1)
    AAA_14; AAA domain (PF13173; HMM-score: 20.9)
    RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 20.6)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 20.6)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 19.3)
    AAA_6; Hydrolytic ATP binding site of dynein motor region (PF12774; HMM-score: 17.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.3)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 16.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.3)
    AAA_18; AAA domain (PF13238; HMM-score: 16.3)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.6)
    AAA_22; AAA domain (PF13401; HMM-score: 15.3)
    ABC_tran; ABC transporter (PF00005; HMM-score: 14.9)
    CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 14.4)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 14.2)
    AAA_PrkA; PrkA AAA domain (PF08298; HMM-score: 13.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.5)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 13.2)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.2)
    AAA_17; AAA domain (PF13207; HMM-score: 13.2)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.1)
    AAA_30; AAA domain (PF13604; HMM-score: 12.5)
    AAA_lid (CL0671) AAA_lid_7; Midasin AAA lid domain (PF17867; HMM-score: 12.5)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 12.2)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9898
    • Cytoplasmic Membrane Score: 0.0008
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0094
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006207
    • TAT(Tat/SPI): 0.000694
    • LIPO(Sec/SPII): 0.000454
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MALKHYKNSDSTVFNDAKALFDLNKNILLKGPTGSGKTKLAETLSEVVDTPMHQVNCSVDLDTESLLGFKTIKTNAEGQQEIVFVDGPVIKAMKEGHILYIDEINMAKPETLPVLNGVLDYRRQITNPYTGEVIKAVPGFNVIAAINEGYVGTLPMNEALKNRFVVIHVDYIDGDILKNVIKEQSLLQDDKQIEQIIKFNEDLRTMSKQGQISEEAASIRALLDLCDLITVMPVERAIKRTIIDKLEDEREQQAIYNAVELNF

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [1] [2]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Lindsey N Shaw, Joanne Aish, Jessica E Davenport, Melanie C Brown, James K Lithgow, Kay Simmonite, Howard Crossley, James Travis, Jan Potempa, Simon J Foster
Investigations into sigmaB-modulated regulatory pathways governing extracellular virulence determinant production in Staphylococcus aureus.
J Bacteriol: 2006, 188(17);6070-80
[PubMed:16923874] [WorldCat.org] [DOI] (P p)