From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1339 [new locus tag: SA_RS07585 ]
  • pan locus tag?: SAUPAN004044000
  • symbol: malR
  • pan gene symbol?: malR
  • synonym:
  • product: maltose operon transcriptional repressor

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1339 [new locus tag: SA_RS07585 ]
  • symbol: malR
  • product: maltose operon transcriptional repressor
  • replicon: chromosome
  • strand: -
  • coordinates: 1546978..1547997
  • length: 1020
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGGTTACGATTAAAGATGTTGCACTAAAAGCCGGTGTTTCTCCTTCGACAGTTTCAAGA
    GTTATAAAAGGAAATAAACGTATTAGCGAAGCGACAATTTCAAAAGTGAAGAAAGTTATG
    GAAGAATTGAATTATTTTCCTAATACCGCTGCTAGAACTTTAATTACAAACCAAACATAT
    AAAATTGGTTTAGTGTTAAAAGGGTCTGAGGAGCCTATTCGACTGAATCCATTCTACATC
    AATGTATTGCTAGGAATTTCTGAAACGTGTAACCAGCATGGCTATGGTACACAAACGACA
    GTCTCAAATAATATGAATGATTTAATGGATGAAGTTTATAAAATGATTAAACAACGAATG
    GTTGATGCGTTTATACTGCTTTATTCAAAAGAAAATGATCCAATTAAACAAATGTTAATT
    GATGAAAGCATGCCATTTATTGTGATTGGTAAGCCTACATCGGATATAGATCATCAATTT
    ACACACATAGATAATGATAATATATTAGCTTCTGAAAATTTGACACGACATGTTATTGAA
    CAAGGTGTAGATGAATTAATATTTATTACAGAAAAAGGAAATTTTGAAGTTTCAAAAGAT
    AGAATTCAAGGATTTGAAACGGTTGCATCACAATTTAATCTGGATTATCAAATTATTGAG
    ACTAGTAATGAAAGAGAAGTTATTTTAAATTACATGCAAAATCTACATACGCGTTTGAAG
    GACCCAAATATTAAACAGGCAATCATTTCGTTAGATGCTATGTTACATTTAGCGATTTTA
    AGTGTCCTATATGAACTTAATATTGAAATTCCGAAAGATGTAATGACAGCAACGTTCAAT
    GATTCTTATTTAACCGAAATTGCGTCACCACCTCAAACCTGTATTGACATCAAGCCTCGA
    ATGTTAGGTCAACAGGCTGGTTCAGCAATTTTAAATATATTGAAAAACAAAGCACAGGAT
    GTTATTGAACTCGTCATTATAGATACAGAATTAAAAATAAGAAAATCAACACAGCGATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1339 [new locus tag: SA_RS07585 ]
  • symbol: MalR
  • description: maltose operon transcriptional repressor
  • length: 339
  • theoretical pI: 5.46166
  • theoretical MW: 38378
  • GRAVY: -0.168142

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions catabolite control protein A (TIGR01481; HMM-score: 114.4)
    Signal transduction Regulatory functions DNA interactions D-fructose-responsive transcription factor (TIGR02417; HMM-score: 111.2)
    and 5 more
    Signal transduction Regulatory functions DNA interactions trehalose operon repressor (TIGR02405; HMM-score: 49.7)
    Genetic information processing Mobile and extrachromosomal element functions Other addiction module antidote protein, HigA family (TIGR02607; HMM-score: 16.2)
    Signal transduction Regulatory functions DNA interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 16.2)
    Signal transduction Regulatory functions Protein interactions addiction module antidote protein, HigA family (TIGR02607; HMM-score: 16.2)
    Hypothetical proteins Conserved TIGR02147 family protein (TIGR02147; HMM-score: 15.4)
  • TheSEED  :
    • Maltose operon transcriptional repressor MalR, LacI family
    Carbohydrates Di- and oligosaccharides Maltose and Maltodextrin Utilization  Maltose operon transcriptional repressor MalR, LacI family
  • PFAM:
    HTH (CL0123) LacI; Bacterial regulatory proteins, lacI family (PF00356; HMM-score: 76.4)
    Periplas_BP (CL0144) Peripla_BP_3; Periplasmic binding protein-like domain (PF13377; HMM-score: 69.3)
    Peripla_BP_1; Periplasmic binding proteins and sugar binding domain of LacI family (PF00532; HMM-score: 65.2)
    and 10 more
    HTH (CL0123) HTH_3; Helix-turn-helix (PF01381; HMM-score: 26.8)
    HTH_Tnp_ISL3; Helix-turn-helix domain of transposase family ISL3 (PF13542; HMM-score: 19.3)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 17)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 16)
    HTH_31; Helix-turn-helix domain (PF13560; HMM-score: 14.5)
    HTH_AraC; Bacterial regulatory helix-turn-helix proteins, AraC family (PF00165; HMM-score: 14.2)
    HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 14)
    no clan defined DUF6853; Family of unknown function (DUF6853) (PF21593; HMM-score: 13.1)
    DUF3993; Protein of unknown function (DUF3993) (PF13158; HMM-score: 12.8)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 12.1)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.64
    • Cytoplasmic Membrane Score: 0.3
    • Cellwall Score: 0.06
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9549
    • Cytoplasmic Membrane Score: 0.0312
    • Cell wall & surface Score: 0.0004
    • Extracellular Score: 0.0135
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010896
    • TAT(Tat/SPI): 0.002098
    • LIPO(Sec/SPII): 0.001269
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVTIKDVALKAGVSPSTVSRVIKGNKRISEATISKVKKVMEELNYFPNTAARTLITNQTYKIGLVLKGSEEPIRLNPFYINVLLGISETCNQHGYGTQTTVSNNMNDLMDEVYKMIKQRMVDAFILLYSKENDPIKQMLIDESMPFIVIGKPTSDIDHQFTHIDNDNILASENLTRHVIEQGVDELIFITEKGNFEVSKDRIQGFETVASQFNLDYQIIETSNEREVILNYMQNLHTRLKDPNIKQAIISLDAMLHLAILSVLYELNIEIPKDVMTATFNDSYLTEIASPPQTCIDIKPRMLGQQAGSAILNILKNKAQDVIELVIIDTELKIRKSTQR

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: CcpA regulon, MalR (repression) regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise 
    MalR(TF)important in Maltose utilization, Maltodextrin utilization; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]