Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0198 [new locus tag: SA_RS01175 ]
- pan locus tag?: SAUPAN001056000
- symbol: oppF
- pan gene symbol?: gisA
- synonym:
- product: oligopeptide transport ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0198 [new locus tag: SA_RS01175 ]
- symbol: oppF
- product: oligopeptide transport ATP-binding protein
- replicon: chromosome
- strand: -
- coordinates: 233345..234937
- length: 1593
- essential: yes [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1122975 NCBI
- RefSeq: NP_373442 NCBI
- BioCyc: see SA_RS01175
- MicrobesOnline: 102468 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561ATGTCAAATTTATTAGAAGTCAACAGTCTGAATGTACAATTCAATTATGATGAAACTACA
GTTCAAGCGGTAAAAAATGTCTCTTTCGAATTACGAAAAAAACATATCCTAGGTATTGTT
GGTGAATCAGGATCAGGAAAAAGTATTACTGCTAAATCTATTTTAGGGCTACTACCAGAT
TATCCAGATCACACATTAACAGGAGAAATTATTTTTAATGGGCAATCGTTAAATAATTTA
TCAACTTCAGCGTTACAACAAATTCGAGGTAAGGATATTTCAATGATTTTTCAAGATCCA
CTCTCTTCGTTGAATCCAAGATTAACGATTGGCAAACAAATTACAGAAGTACTATTTCAA
CATAAACGTGTATCTAAATCTGAAGCAAAGTCGATGACAATAAACATTTTAGAAAAAGTA
GGTATAAAACATGCAACTCGACAATTTGATGCTTATCCACATGAACTTTCTGGTGGTATG
CGTCAACGTGTCATGATAGCAATGGCATTGATTTTAAAGCCACAAATTTTAATCGCAGAT
GAACCAACAACGGCATTAGATGCCAGTACACAAAATCAATTACTGCAGTTAATGAAGTCC
CTTTATGAGTACACAGAAACATCTATTATTTTTATCACTCACGATTTAGGCGCTGTGTAT
CAATTTTGCGACGATGTGATTGTAATGAAAGATGGAAGTGTCGTTGAAAGTGGCACGGTT
GAAAGTATTTTTAAATCGCCACAACATACCTATACAAAACGCTTAATAGATGCGATTCCT
GATATTCATCAAACGCGTCCGCCAAGACCGTTAAACAATGATATTTTATTAAAATTCGAT
CGCGTGAGCGTGGATTACACATCACCGAGTGGCAGCCTATACCGAGCAGTTAATGATATT
AACTTGGCTATTAGAAAAGGCGAAACATTAGGCATTGTCGGTGAATCAGGGTCAGGGAAA
TCGACATTAGCTAAGACGGTCGTCGGTCTAAAGGAAGTGTCAGAAGGCTTTATTTGGTAT
AACGAATTACCATTAAGTTTATTTAAAGATGATGAATTGAAATCTTTACGACAAGAGATA
CAAATGATTTTTCAAGATCCATTCGCATCTATTAATCCAAGATTTAAAGTCATTGATGTG
ATTAAACGACCACTAATCATTCATGGGAAAGTCAAAGATAATGATGACATTATTAAAACT
GTCGTATCGTTGTTAGAAAAGGTTGGCCTAGATCAAAGTTTCTTATATCGCTATCCACAC
GAATTATCTGGTGGGCAACGTCAGCGTGTAAGTATCGCGAGAGCACTTGCTGTAGAACCT
AAAGTGATTGTTTGCGACGAGGCAGTGTCCGCTTTAGACGTTTCAATTCAAAAAGATATC
ATCGAGTTATTAAAACAATTACAGTTAGACTTCGGCATCACTTATTTATTCATCACACAT
GACATGGGTGTTATCAATGAAATATGTGATCGCGTTGCAGTTATGAAAAATGGCGAAATC
GTTGAACTGAATAACACAGAAGATATTATCAAACATCCGCAATCAGACTATGCAAAGCAA
CTTATTTCAGAAGTAGCAGTTATTGCTAAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1440
1500
1560
1593
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0198 [new locus tag: SA_RS01175 ]
- symbol: OppF
- description: oligopeptide transport ATP-binding protein
- length: 530
- theoretical pI: 6.38891
- theoretical MW: 59160.8
- GRAVY: -0.0815094
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 447.5)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 412.9)and 81 moreD-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 332.3)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 326.2)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 322.8)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 305.7)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 290.5)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 290.5)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 279)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 277.6)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 276.8)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 270.8)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 266.9)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 261.9)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 259.6)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 245.5)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 234.5)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 234.5)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 231.3)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 229.6)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 226)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 218.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 218.2)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 216.2)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 212.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 212.6)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 212.1)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 212.1)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 210.5)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 207.5)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 199.5)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 199.5)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 195)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 195)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 195)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 191.8)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 191)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 188)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 188)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.3)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.3)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 184)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 181.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 181.3)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 179.9)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 178.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 178.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 177.6)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 174.2)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 170.5)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 164.6)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 162.2)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 158.3)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 154.5)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 144.2)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 144.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 140.7)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 135.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 135.8)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 132.7)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.9)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.9)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 109.8)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 96.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 85.1)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 85.1)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 81.4)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 75.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 68.8)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68.3)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 64.6)Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 42)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 19.2)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 17.4)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 15.2)Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 15.2)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 13.8)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssC (TIGR03928; HMM-score: 11.9)Mobile and extrachromosomal element functions Plasmid functions plasmid transfer ATPase TraJ (TIGR02525; HMM-score: 11.6)Central intermediary metabolism Nitrogen fixation Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)Regulatory functions DNA interactions Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 10.4)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 8.7)
- TheSEED :
- ABC transporter, ATP-binding protein (cluster 5, nickel/peptides/opines)
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 222.4)and 49 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 53.6)AAA_22; AAA domain (PF13401; HMM-score: 41.5)no clan defined oligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 40.2)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 34.1)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 29.4)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 26.5)NB-ARC; NB-ARC domain (PF00931; HMM-score: 26)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 24.8)ABC_ATPase; P-loop domain (PF09818; HMM-score: 23.5)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 23)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 22.8)AAA_16; AAA ATPase domain (PF13191; HMM-score: 22.8)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 22.1)AAA_23; AAA domain (PF13476; HMM-score: 22)NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 22)DUF87; Helicase HerA, central domain (PF01935; HMM-score: 21.9)TniB; Bacterial TniB protein (PF05621; HMM-score: 21.2)NACHT; NACHT domain (PF05729; HMM-score: 20.3)AAA_33; AAA domain (PF13671; HMM-score: 19.2)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 18.9)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 18.9)AAA_24; AAA domain (PF13479; HMM-score: 17.5)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.5)AAA_18; AAA domain (PF13238; HMM-score: 17.2)AAA_19; AAA domain (PF13245; HMM-score: 16.9)RNA_helicase; RNA helicase (PF00910; HMM-score: 16.6)ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 16.5)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.1)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16.1)ATPase; KaiC (PF06745; HMM-score: 16)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 15.9)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.7)Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 15.4)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 14.9)PhoH; PhoH-like protein (PF02562; HMM-score: 14.1)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.6)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 13.2)HTH (CL0123) DUF6262; Family of unknown function (DUF6262) (PF19776; HMM-score: 12.9)P-loop_NTPase (CL0023) MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 12.6)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.5)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 12)AAA_13; AAA domain (PF13166; HMM-score: 11.4)Cache (CL0165) dCache_2; Cache domain (PF08269; HMM-score: 11.3)P-loop_NTPase (CL0023) G-alpha; G-protein alpha subunit (PF00503; HMM-score: 11.2)AAA_10; AAA-like domain (PF12846; HMM-score: 11.1)no clan defined DUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 10.6)P-loop_NTPase (CL0023) SLFN-g3_helicase; Schlafen group 3, DNA/RNA helicase domain (PF09848; HMM-score: 10.3)AAA_15; AAA ATPase domain (PF13175; HMM-score: 9.7)AIG1; AIG1 family (PF04548; HMM-score: 9.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.1216
- Cytoplasmic Membrane Score: 0.8607
- Cell wall & surface Score: 0.0007
- Extracellular Score: 0.0169
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006678
- TAT(Tat/SPI): 0.000447
- LIPO(Sec/SPII): 0.000277
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSNLLEVNSLNVQFNYDETTVQAVKNVSFELRKKHILGIVGESGSGKSITAKSILGLLPDYPDHTLTGEIIFNGQSLNNLSTSALQQIRGKDISMIFQDPLSSLNPRLTIGKQITEVLFQHKRVSKSEAKSMTINILEKVGIKHATRQFDAYPHELSGGMRQRVMIAMALILKPQILIADEPTTALDASTQNQLLQLMKSLYEYTETSIIFITHDLGAVYQFCDDVIVMKDGSVVESGTVESIFKSPQHTYTKRLIDAIPDIHQTRPPRPLNNDILLKFDRVSVDYTSPSGSLYRAVNDINLAIRKGETLGIVGESGSGKSTLAKTVVGLKEVSEGFIWYNELPLSLFKDDELKSLRQEIQMIFQDPFASINPRFKVIDVIKRPLIIHGKVKDNDDIIKTVVSLLEKVGLDQSFLYRYPHELSGGQRQRVSIARALAVEPKVIVCDEAVSALDVSIQKDIIELLKQLQLDFGITYLFITHDMGVINEICDRVAVMKNGEIVELNNTEDIIKHPQSDYAKQLISEVAVIAK
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: CymR* (repression) regulon
CymR* (TF) important in Cysteine metabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p) - ↑ 2.0 2.1 2.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)