Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_001651
- pan locus tag?: SAUPAN004282000
- symbol: hemL
- pan gene symbol?: hemL
- synonym:
- product: glutamate-1-semialdehyde 2,1-aminomutase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_001651
- symbol: hemL
- product: glutamate-1-semialdehyde 2,1-aminomutase
- replicon: chromosome
- strand: -
- coordinates: 1685188..1686474
- length: 1287
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261ATGAGATATACGAAATCAGAAGAAGCAATGAAGGTTGCTGAAACTTTAATGCCTGGTGGT
GTAAATAGTCCAGTACGCGCATTTAAATCAGTAGATACACCAGCAATTTTTATGGATCAC
GGTAAAGGCTCAAAAATTTATGATATCGATGGTAACGAGTATATCGACTATGTACTAAGT
TGGGGGCCGCTTATTTTAGGACATAGAGACCCTCAAGTTATTAGTCATTTACATGAAGCA
ATTGATAAAGGTACAAGTTTTGGTGCATCAACATTACTTGAAAATAAATTGGCGCAGCTC
GTTATTGACCGAGTACCTTCAATAGAAAAAGTGCGTATGGTGTCATCTGGTACAGAAGCT
ACATTGGATACTTTAAGATTAGCACGTGGTTATACTGGCAGAAATAAAATTGTGAAATTT
GAAGGTTGCTATCATGGTCATAGTGATTCGTTATTAATCAAAGCTGGTTCTGGGGTGGCA
ACATTAGGATTGCCGGATTCTCCTGGTGTGCCTGAAGGTATTGCTAAAAATACAATTACA
GTTCCATACAATGATTTAGATGCACTTAAAATCGCTTTCGAAAAATTTGGAGACGATATT
GCTGGTGTAATCGTAGAACCTGTTGCTGGTAATATGGGTGTCGTACCACCGATTGAAGGT
TTTTTACAGGGATTAAGAGATATTACGACTGAATACGGCGCATTGCTAATTTTCGATGAA
GTAATGACTGGTTTCAGAGTCGGTTATCATTGTGCACAAGGTTACTTTGGTGTGACACCA
GATTTAACTTGCTTAGGAAAAGTTATCGGTGGAGGACTACCTGTAGGTGCTTTTGGTGGT
AAAAAAGAAATCATGGATCATATAGCACCATTAGGAAATATTTATCAAGCGGGTACGTTA
TCAGGAAATCCTCTTGCAATGACAAGTGGTTATGAAACGTTAAGCCAATTAACGCCAGAG
ACATATGAGTATTTTAATATGTTAGGCGATATACTTGAAGACGGTTTAAAGCGTGTATTT
GCTAAACACAATGTACCAATAACTGTAAATAGAGCAGGTTCAATGATTGGTTATTTCTTA
AATGAAGGACCTGTAACTAATTTTGAACAAGCGAATAAAAGTGATTTGAAATTATTTGCA
GAAATGTATCGAGAAATGGCAAAAGAAGGTGTGTTTTTACCACCATCTCAATTTGAAGGT
ACATTCTTATCTACGGCACACACGAAAGAAGATATTGAAAAAACGATTCAAGCATTTGAT
ACGGCTTTAAGTCGTATTGTAAAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1287
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_001651
- symbol: HemL
- description: glutamate-1-semialdehyde 2,1-aminomutase
- length: 428
- theoretical pI: 5.16962
- theoretical MW: 46388.8
- GRAVY: -0.0616822
⊟Function[edit | edit source]
- reaction: EC 5.4.3.8? ExPASyGlutamate-1-semialdehyde 2,1-aminomutase (S)-4-amino-5-oxopentanoate = 5-aminolevulinate
- TIGRFAM: Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin glutamate-1-semialdehyde-2,1-aminomutase (TIGR00713; EC 5.4.3.8; HMM-score: 624.7)and 10 moretransaminase, acetylornithine/succinylornithine family (TIGR00707; HMM-score: 179.4)Energy metabolism Amino acids and amines succinylornithine transaminase family (TIGR03246; EC 2.6.1.81; HMM-score: 144.1)ornithine--oxo-acid transaminase (TIGR01885; EC 2.6.1.13; HMM-score: 134.9)Central intermediary metabolism Other 4-aminobutyrate transaminase (TIGR00700; EC 2.6.1.19; HMM-score: 132)Central intermediary metabolism Other 2,4-diaminobutyrate 4-transaminase (TIGR00709; EC 2.6.1.-; HMM-score: 125.5)Central intermediary metabolism Polyamine biosynthesis putrescine aminotransferase (TIGR03372; EC 2.6.1.82; HMM-score: 123.4)Biosynthesis of cofactors, prosthetic groups, and carriers Biotin adenosylmethionine-8-amino-7-oxononanoate transaminase (TIGR00508; EC 2.6.1.62; HMM-score: 121.1)Cellular processes Adaptations to atypical conditions diaminobutyrate--2-oxoglutarate aminotransferase (TIGR02407; EC 2.6.1.76; HMM-score: 90.1)L-lysine 6-transaminase (TIGR03251; EC 2.6.1.36; HMM-score: 47.5)Central intermediary metabolism Other 4-aminobutyrate aminotransferase (TIGR00699; EC 2.6.1.19; HMM-score: 28.1)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: PLP_aminotran (CL0061) Aminotran_3; Aminotransferase class-III (PF00202; HMM-score: 248.6)and 1 moreAminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 14.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.978
- Cytoplasmic Membrane Score: 0.002
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0199
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.024734
- TAT(Tat/SPI): 0.002182
- LIPO(Sec/SPII): 0.001986
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MRYTKSEEAMKVAETLMPGGVNSPVRAFKSVDTPAIFMDHGKGSKIYDIDGNEYIDYVLSWGPLILGHRDPQVISHLHEAIDKGTSFGASTLLENKLAQLVIDRVPSIEKVRMVSSGTEATLDTLRLARGYTGRNKIVKFEGCYHGHSDSLLIKAGSGVATLGLPDSPGVPEGIAKNTITVPYNDLDALKIAFEKFGDDIAGVIVEPVAGNMGVVPPIEGFLQGLRDITTEYGALLIFDEVMTGFRVGYHCAQGYFGVTPDLTCLGKVIGGGLPVGAFGGKKEIMDHIAPLGNIYQAGTLSGNPLAMTSGYETLSQLTPETYEYFNMLGDILEDGLKRVFAKHNVPITVNRAGSMIGYFLNEGPVTNFEQANKSDLKLFAEMYREMAKEGVFLPPSQFEGTFLSTAHTKEDIEKTIQAFDTALSRIVK
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_001649 < JSNZ_001650 < hemL < hemB < JSNZ_001653 < hemC < ccsA < hemA
⊟Regulation[edit | edit source]
- regulator: LacR* (repression) regulon
LacR* (TF) important in Lactose utilization; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)