Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_001201
- pan locus tag?: SAUPAN003519000
- symbol: JSNZ_001201
- pan gene symbol?: acpP
- synonym:
- product: acyl carrier protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_001201
- symbol: JSNZ_001201
- product: acyl carrier protein
- replicon: chromosome
- strand: +
- coordinates: 1205769..1206002
- length: 234
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181GTGGAAAATTTCGATAAAGTAAAAGATATCATCGTTGACCGTTTAGGTGTAGACGCTGAT
AAAGTAACTGAAGATGCATCTTTCAAAGATGATTTAGGCGCTGACTCACTTGATATCGCT
GAATTAGTAATGGAATTAGAAGACGAGTTTGGTACTGAAATTCCTGATGAAGAAGCTGAA
AAAATCAACACTGTTGGTGATGCTGTTAAATTTATTAACAGTCTTGAAAAATAA60
120
180
234
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_001201
- symbol: JSNZ_001201
- description: acyl carrier protein
- length: 77
- theoretical pI: 3.72176
- theoretical MW: 8549.37
- GRAVY: -0.376623
⊟Function[edit | edit source]
- TIGRFAM: Fatty acid and phospholipid metabolism Biosynthesis acyl carrier protein (TIGR00517; HMM-score: 109.8)and 1 moreCellular processes Toxin production and resistance peptide maturation system acyl carrier-related protein (TIGR04069; HMM-score: 17.9)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: PP-binding (CL0314) PP-binding; Phosphopantetheine attachment site (PF00550; HMM-score: 61.4)and 4 moreDUF7080; Domain of unknown function (DUF7080) (PF23297; HMM-score: 17.5)PP-binding_2; Acyl-carrier (PF14573; HMM-score: 16.4)Ribosomal_L50; Ribosomal subunit 39S (PF10501; HMM-score: 14.9)no clan defined Ribosomal_L12_N; Ribosomal protein L7/L12 dimerisation domain (PF16320; HMM-score: 13.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9868
- Cytoplasmic Membrane Score: 0.0009
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0121
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003188
- TAT(Tat/SPI): 0.000506
- LIPO(Sec/SPII): 0.00048
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MENFDKVKDIIVDRLGVDADKVTEDASFKDDLGADSLDIAELVMELEDEFGTEIPDEEAEKINTVGDAVKFINSLEK
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)