Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS13265 [old locus tag: EGJ38_002657 ]
- pan locus tag?: SAUPAN006412000
- symbol: icaD
- pan gene symbol?: icaD
- synonym:
- product: intracellular adhesion protein IcaD
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS13265 [old locus tag: EGJ38_002657 ]
- symbol: icaD
- product: intracellular adhesion protein IcaD
- replicon: chromosome
- strand: +
- coordinates: 2675874..2676179
- length: 306
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (2675874..2676179) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
TCGTGA60
120
180
240
300
306
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS13265 [old locus tag: EGJ38_002657 ]
- symbol: IcaD
- description: intracellular adhesion protein IcaD
- length: 101
- theoretical pI: 5.82065
- theoretical MW: 11782.9
- GRAVY: 0.670297
⊟Function[edit | edit source]
- TIGRFAM: Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)and 2 moreCell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)integral membrane protein (TIGR04561; HMM-score: 5)
- TheSEED: data available for COL, N315, NCTC8325, Newman
- PFAM: APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.1)and 4 moreTransporter (CL0375) TMEM127; Transmembrane protein 127 (PF20517; HMM-score: 14.2)TrbL (CL0698) TrbL_4; Conjugal transfer protein TrbL (PF19597; HMM-score: 13.2)no clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 12.6)DUF2207_C; Predicted membrane protein (DUF2207) C-terminal domain (PF20990; HMM-score: 11.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.01
- Cytoplasmic Membrane Score: 9.99
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 2
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9886
- Cell wall & surface Score: 0
- Extracellular Score: 0.0113
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.000853
- TAT(Tat/SPI): 0.000208
- LIPO(Sec/SPII): 0.023432
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000240580 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CodY, IcaR see EGJ38_002657
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]