Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS12015 [old locus tag: EGJ38_002407 ]
- pan locus tag?: SAUPAN005981000
- symbol: EGJ38_RS12015
- pan gene symbol?: —
- synonym:
- product: membrane protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS12015 [old locus tag: EGJ38_002407 ]
- symbol: EGJ38_RS12015
- product: membrane protein
- replicon: chromosome
- strand: +
- coordinates: 2404575..2405234
- length: 660
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (2404575..2405234) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGAAAAGAACTGATAAATACCGTGATTCATATCAATACGACAATCAAAACCAAAATCAT
CGTCGTCAATCTGAAGACGCATCGTATAGACAACAATATGCTAAAGGCGATCCTGAAGAA
CACCCGGAACGATACTATAATGGTAGAGATTATCGAAGAGAACAAATTCTTGAAGAAGAA
AACGAGAAATCCCGCCGTTCAAAAAAATGGTTATATATCATTATTGCCATTCTCTTAATT
ATTGTCGCTATTTTTGTCACACGCGCCTTACTTAACAATGATAGCGATAAAGTTAGTAAT
GACCCTAAAGTCTCTCAAAATTATAAAAAACAAGTTGAAAATCAAGACGGCCAAATTAAC
CAGCAAGTTGATAATGCTAAAGAAAATATTAAAAACAACCAAAAAACTGATGACATTATT
AAAAATTTACAAAATCAAATCGACAACTTGAAGCAGCAAGAACAAAACAAAGCTGATTCT
AAGCTAACTCAATTTTATCAAGACCAAATCAACAAATTGACAGAGGCAAATAATGCACTT
AAAAACAATGCAAGCCAAGGTAAAATTGAAAGCATGTTAAATGATATTAATACAAAATTC
GACAGTATTAAATCTAAATTAGAAAGCTTATTTAAAGATGACAATGGTGGCGCTAATTAA60
120
180
240
300
360
420
480
540
600
660
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS12015 [old locus tag: EGJ38_002407 ]
- symbol: EGJ38_RS12015
- description: membrane protein
- length: 219
- theoretical pI: 8.61585
- theoretical MW: 25799.2
- GRAVY: -1.38402
⊟Function[edit | edit source]
- TIGRFAM: TIGR03943 family protein (TIGR03943; HMM-score: 15.1)Protein fate Protein folding and stabilization cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)Energy metabolism Electron transport cytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 13.7)and 11 moreCellular processes Pathogenesis type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)Protein fate Protein and peptide secretion and trafficking type IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)Cellular processes Toxin production and resistance thiopeptide-type bacteriocin biosynthesis domain (TIGR03891; HMM-score: 11.1)Hypothetical proteins Conserved TIGR00366 family protein (TIGR00366; HMM-score: 10.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-galactonate transporter (TIGR00893; HMM-score: 10)Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10)conjugal transfer/type IV secretion protein DotA/TraY (TIGR04346; HMM-score: 9.1)phage lysis regulatory protein, LysB family (TIGR03495; HMM-score: 5.6)two transmembrane protein (TIGR04527; HMM-score: 4.7)Cellular processes Pathogenesis type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)Protein fate Protein and peptide secretion and trafficking type III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: no clan defined DUF4094; Domain of unknown function (DUF4094) (PF13334; HMM-score: 19.4)GlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 18.9)FRB_dom; FKBP12-rapamycin binding domain (PF08771; HMM-score: 18.5)Med9; RNA polymerase II transcription mediator complex subunit 9 (PF07544; HMM-score: 17.1)Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 16.9)no clan defined EntA_Immun; Enterocin A Immunity (PF08951; HMM-score: 16.8)SNARE-fusion (CL0445) SNARE; SNARE domain (PF05739; HMM-score: 16.2)no clan defined RIG-I_C; RIG-I receptor C-terminal domain (PF18119; HMM-score: 16)and 25 moreCep57_MT_bd; Centrosome microtubule-binding domain of Cep57 (PF06657; HMM-score: 13.9)DUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 13.7)INV_N; Beta-fructofuranosidase, N-terminal domain (PF11837; HMM-score: 13.1)SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 13)ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 12.9)ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 12.7)PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 12.5)ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 12.3)Tbcl_zf (CL0839) DUF2116; Probable treble clef (PF09889; HMM-score: 12.3)MFS (CL0015) MFS_Mycoplasma; Mycoplasma MFS transporter (PF07672; HMM-score: 12.1)no clan defined DUF6480; Family of unknown function (DUF6480) (PF20088; HMM-score: 11.7)IT (CL0182) SCFA_trans; Short chain fatty acid transporter (PF02667; HMM-score: 10.7)no clan defined Piezo_TM1-24; Piezo TM1-24 (PF24871; HMM-score: 10.2)T2SSF; Type II secretion system (T2SS), protein F (PF00482; HMM-score: 9.5)HEF_HK; HEF_HK domain (PF19191; HMM-score: 9.1)YtxH; YtxH-like protein (PF12732; HMM-score: 9)DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 8.8)Saposin_like (CL0707) SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 8.8)no clan defined DUF6779; Domain of unknown function (DUF6779) (PF20570; HMM-score: 8.3)LprI; Lysozyme inhibitor LprI (PF07007; HMM-score: 7.9)GT-B (CL0113) FUT8_N_cat; Alpha-(1,6)-fucosyltransferase N- and catalytic domains (PF19745; HMM-score: 7.4)MFS (CL0015) SLC52_ribofla_tr; Solute carrier family 52, riboflavin transporter (PF06237; HMM-score: 7.3)no clan defined DUF2408; Protein of unknown function (DUF2408) (PF10303; HMM-score: 7.2)TSPAN_4TM-like (CL0347) Tetraspanin; Tetraspanin family (PF00335; HMM-score: 6.4)no clan defined AI-2E_transport; AI-2E family transporter (PF01594; HMM-score: 5.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9451
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0547
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.023157
- TAT(Tat/SPI): 0.00401
- LIPO(Sec/SPII): 0.008892
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000831298 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MKRTDKYRDSYQYDNQNQNHRRQSEDASYRQQYAKGDPEEHPERYYNGRDYRREQILEEENEKSRRSKKWLYIIIAILLIIVAIFVTRALLNNDSDKVSNDPKVSQNYKKQVENQDGQINQQVDNAKENIKNNQKTDDIIKNLQNQIDNLKQQEQNKADSKLTQFYQDQINKLTEANNALKNNASQGKIESMLNDINTKFDSIKSKLESLFKDDNGGAN
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: VraR see EGJ38_002407
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]