Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS09650 [old locus tag: EGJ38_001933 ]
- pan locus tag?: SAUPAN004928000
- symbol: gatC
- pan gene symbol?: gatC
- synonym:
- product: Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS09650 [old locus tag: EGJ38_001933 ]
- symbol: gatC
- product: Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
- replicon: chromosome
- strand: -
- coordinates: 1946726..1947028
- length: 303
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (1946726..1947028) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATT
TCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAA
CAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAA
AACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCGCAAGAATTAGCTTTGAAAAAT
GCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACGCG
TAA60
120
180
240
300
303
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS09650 [old locus tag: EGJ38_001933 ]
- symbol: GatC
- description: Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
- length: 100
- theoretical pI: 4.09552
- theoretical MW: 11267.4
- GRAVY: -0.692
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis tRNA aminoacylation aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit (TIGR00135; EC 6.3.5.-; HMM-score: 96.6)and 1 moreputative Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase, subunit C (TIGR01827; HMM-score: 21.3)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: GatC-like (CL0735) GatC; Glu-tRNAGln amidotransferase C subunit (PF02686; HMM-score: 81.7)and 2 moreGta3; Glutamyl-tRNA amidotransferase complex subunit Gta3 (PF20978; HMM-score: 21.5)no clan defined DUF6137; Family of unknown function (DUF6137) (PF19634; HMM-score: 17.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9984
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.0014
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003484
- TAT(Tat/SPI): 0.000302
- LIPO(Sec/SPII): 0.00075
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000170162 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDA
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]