From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1962 [new locus tag: SACOL_RS10260 ]
  • symbol: gatC
  • product: aspartyl/glutamyl-tRNA amidotransferase subunit C
  • replicon: chromosome
  • strand: -
  • coordinates: 2023183..2023485
  • length: 303
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATT
    TCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAA
    CAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAA
    AACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCACAAGAATTAGCTTTGAAAAAT
    GCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACGCG
    TAA
    60
    120
    180
    240
    300
    303

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1962 [new locus tag: SACOL_RS10260 ]
  • symbol: GatC
  • description: aspartyl/glutamyl-tRNA amidotransferase subunit C
  • length: 100
  • theoretical pI: 4.09552
  • theoretical MW: 11267.4
  • GRAVY: -0.692

Function[edit | edit source]

  • reaction:
    EC 6.3.5.-?  ExPASy
    ATP + L-glutamyl-tRNA(Gln) + L-glutamine = ADP + phosphate + L-glutaminyl-tRNA(Gln) + L-glutamate? ATP + L-aspartyl-tRNA(Asn) + L-glutamine = ADP + phosphate + L-asparaginyl-tRNA(Asn) + L-glutamate?
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA aminoacylation aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit (TIGR00135; EC 6.3.5.-; HMM-score: 96.6)
    and 1 more
    putative Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase, subunit C (TIGR01827; HMM-score: 21.3)
  • TheSEED  :
    • Aspartyl-tRNA(Asn) amidotransferase subunit C (EC 6.3.5.6)
    • Glutamyl-tRNA(Gln) amidotransferase subunit C (EC 6.3.5.7)
    Protein Metabolism Protein biosynthesis tRNA aminoacylation, Glu and Gln  Glutamyl-tRNA(Gln) amidotransferase subunit C (EC 6.3.5.7)
  • PFAM:
    GatC-like (CL0735) GatC; Glu-tRNAGln amidotransferase C subunit (PF02686; HMM-score: 81.7)
    and 2 more
    Gta3; Glutamyl-tRNA amidotransferase complex subunit Gta3 (PF20978; HMM-score: 21.5)
    no clan defined DUF6137; Family of unknown function (DUF6137) (PF19634; HMM-score: 17.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9984
    • Cytoplasmic Membrane Score: 0.0002
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0014
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003484
    • TAT(Tat/SPI): 0.000302
    • LIPO(Sec/SPII): 0.00075
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDA

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2]
  • quantitative data / protein copy number per cell: 2872 [3]
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 22.6 h [4]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  4. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]