Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS12435 [old locus tag: SACOL2368 ]
- pan locus tag?: SAUPAN005889000
- symbol: SACOL_RS12435
- pan gene symbol?: —
- synonym:
- product: N-acetyltransferase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS12435 [old locus tag: SACOL2368 ]
- symbol: SACOL_RS12435
- product: N-acetyltransferase
- replicon: chromosome
- strand: -
- coordinates: 2428786..2429121
- length: 336
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAGTCCAAAGACGCGCGAAGCAGCTGAAAAAGGATTACCTAATGCCTTATTTACAGTA
ACCTTGTATGATAAAGATCGGTTAATTGGTATGGGTAGAGTGATTGGCGATGGCGGAACT
GTTTTTCAAATTGTTGATATTGCAGTTTTGAAAAGTTACCAAGGTCAAGGTTACGGCAGT
CTAATTATGGAGCATATTATGCAATATATTAAAGGTGTGGCTGTTGAGAGTACATACGTT
AGTCTGATTGCAGACTACCCAGCGGATAAATTATATACAAAATTTGGATTTATACCTACC
GAACCAGATTCAGGCGGTATGTATATCAAATACTAA60
120
180
240
300
336
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS12435 [old locus tag: SACOL2368 ]
- symbol: SACOL_RS12435
- description: N-acetyltransferase
- length: 111
- theoretical pI: 5.83017
- theoretical MW: 12225.1
- GRAVY: 0.0027027
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal-protein-alanine acetyltransferase (TIGR01575; EC 2.3.1.128; HMM-score: 30.9)
- TheSEED: see SACOL2368
- ⊞PFAM: Acetyltrans (CL0257) Acetyltransf_1; Acetyltransferase (GNAT) family (PF00583; HMM-score: 49.9)Acetyltransf_7; Acetyltransferase (GNAT) domain (PF13508; HMM-score: 49.6)Acetyltransf_10; Acetyltransferase (GNAT) domain (PF13673; HMM-score: 46.5)and 5 more
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSPKTREAAEKGLPNALFTVTLYDKDRLIGMGRVIGDGGTVFQIVDIAVLKSYQGQGYGSLIMEHIMQYIKGVAVESTYVSLIADYPADKLYTKFGFIPTEPDSGGMYIKY
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- data available for JSNZ
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available