NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

organism: Staphylococcus aureus COL

locus tag: SACOL1962 [new locus tag: SACOL_RS10260 ]

pan locus tag^?: SAUPAN004928000

symbol: gatC

pan gene symbol^?: gatC

synonym:
product: aspartyl/glutamyl-tRNA amidotransferase subunit C

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

type: CDS
locus tag: SACOL1962 [new locus tag: SACOL_RS10260 ]
symbol: gatC
product: aspartyl/glutamyl-tRNA amidotransferase subunit C
replicon: chromosome
strand: -
coordinates: 2023183..2023485
length: 303
essential: unknown other strains

⊟Accession numbers[edit | edit source]

Gene ID: 3237500 NCBI
RefSeq: YP_186786 NCBI
BioCyc: see SACOL_RS10260
MicrobesOnline: 913440 MicrobesOnline

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

1
61
121
181
241
301
ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATT
TCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAA
CAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAA
AACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCACAAGAATTAGCTTTGAAAAAT
GCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACGCG
TAA
60
120
180
240
300
303

⊟Protein[edit | edit source]

⊟General[edit | edit source]

locus tag: SACOL1962 [new locus tag: SACOL_RS10260 ]
symbol: GatC
description: aspartyl/glutamyl-tRNA amidotransferase subunit C
length: 100
theoretical pI: 4.09552
theoretical MW: 11267.4
GRAVY: -0.692

⊟Function[edit | edit source]

⊞⊞reaction:
EC 6.3.5.-? ExPASy
ATP + L-glutamyl-tRNA(Gln) + L-glutamine = ADP + phosphate + L-glutaminyl-tRNA(Gln) + L-glutamate? ATP + L-aspartyl-tRNA(Asn) + L-glutamine = ADP + phosphate + L-asparaginyl-tRNA(Asn) + L-glutamate?
⊞⊞TIGRFAM:
Genetic information processing Protein synthesis tRNA aminoacylation aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit (TIGR00135; EC 6.3.5.-; HMM-score: 96.6)
and 1 more
putative Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase, subunit C (TIGR01827; HMM-score: 21.3)
TheSEED :
- Aspartyl-tRNA(Asn) amidotransferase subunit C (EC 6.3.5.6)
- Glutamyl-tRNA(Gln) amidotransferase subunit C (EC 6.3.5.7)
Protein Metabolism Protein biosynthesis tRNA aminoacylation, Glu and Gln Glutamyl-tRNA(Gln) amidotransferase subunit C (EC 6.3.5.7)
⊞⊞PFAM:
GatC-like (CL0735) GatC; Glu-tRNAGln amidotransferase C subunit (PF02686; HMM-score: 81.7)
and 2 more
Gta3; Glutamyl-tRNA amidotransferase complex subunit Gta3 (PF20978; HMM-score: 21.5)
no clan defined DUF6137; Family of unknown function (DUF6137) (PF19634; HMM-score: 17.8)

⊟Structure, modifications & cofactors[edit | edit source]

domains:
modifications:
cofactors:
effectors:

⊟Localization[edit | edit source]

⊞⊞
PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
⊞⊞
DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9984
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.0014
⊞⊞
LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
⊞⊞
SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003484
- TAT(Tat/SPI): 0.000302
- LIPO(Sec/SPII): 0.00075
predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

GI: 57652122 NCBI
RefSeq: YP_186786 NCBI
UniProt: Q5HEM1 UniProt

⊟Protein sequence[edit | edit source]

MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDA

⊟Experimental data[edit | edit source]

experimentally validated: PeptideAtlas
protein localization: Cytoplasmic ^[1] ^[2]
quantitative data / protein copy number per cell: 2872 ^[3]
interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

MicrobesOnline: gatB < gatA < gatC

⊟Regulation[edit | edit source]

regulator:

⊟Transcription pattern[edit | edit source]

S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

Aureolib: no data available

⊟Protein stability[edit | edit source]

half-life: 22.6 h ^[4]

⊞Biological Material[edit | edit source]

⊞Other Information[edit | edit source]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e)
↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)
↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)
↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

[pubmed19997597-1] Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e)

[pubmed24439828-2] Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)

[pubmed27344979-3] Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)

[pubmed22556279-4] Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)

[1]

[2]

[3]

[4]

Search

Navigation menu

Links

⊟Summary[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟DNA sequence[edit | edit source]

⊟Protein[edit | edit source]

⊟General[edit | edit source]

⊟Function[edit | edit source]

⊟Structure, modifications & cofactors[edit | edit source]

⊟Localization[edit | edit source]

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

⊞Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊞Other Information[edit | edit source]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

⊟Summary[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟DNA sequence[edit | edit source]

⊟Protein[edit | edit source]

⊟General[edit | edit source]

⊟Function[edit | edit source]

⊟Structure, modifications & cofactors[edit | edit source]

⊟Localization[edit | edit source]

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

⊞Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊞Other Information[edit | edit source]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]