Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS04420 [old locus tag: SACOL0861 ]
- pan locus tag?: SAUPAN002802000
- symbol: SACOL_RS04420
- pan gene symbol?: cspC
- synonym:
- product: cold-shock protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS04420 [old locus tag: SACOL0861 ]
- symbol: SACOL_RS04420
- product: cold-shock protein
- replicon: chromosome
- strand: +
- coordinates: 888753..888953
- length: 201
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ATGAATAACGGTACAGTTAAATGGTTTAATGCAGAAAAAGGTTTTGGTTTCATCGAAAGA
GAAGATGGTAGCGACGTATTCGTACACTTCTCAGCAATCGCTGAAGATGGATACAAATCA
TTAGAAGAAGGCCAAAAAGTTGAATTCGACATCGTTGAAGGCGACCGTGGCGAGCAAGCT
GCAAACGTAGTTAAAATGTAA60
120
180
201
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS04420 [old locus tag: SACOL0861 ]
- symbol: SACOL_RS04420
- description: cold-shock protein
- length: 66
- theoretical pI: 4.18132
- theoretical MW: 7374.06
- GRAVY: -0.513636
⊟Function[edit | edit source]
- ⊞TIGRFAM: Cellular processes Adaptations to atypical conditions cold shock domain protein CspD (TIGR02381; HMM-score: 91.9)DNA metabolism DNA replication, recombination, and repair cold shock domain protein CspD (TIGR02381; HMM-score: 91.9)and 1 more
- TheSEED: see SACOL0861
- ⊞PFAM: OB (CL0021) CSD; 'Cold-shock' DNA-binding domain (PF00313; HMM-score: 110)and 4 more
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNNGTVKWFNAEKGFGFIEREDGSDVFVHFSAIAEDGYKSLEEGQKVEFDIVEGDRGEQAANVVKM
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available