From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0761 [new locus tag: NWMN_RS04305 ]
  • pan locus tag?: SAUPAN002802000
  • symbol: cspC
  • pan gene symbol?: cspC
  • synonym:
  • product: cold-shock protein CSD family protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_0761 [new locus tag: NWMN_RS04305 ]
  • symbol: cspC
  • product: cold-shock protein CSD family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 857867..858067
  • length: 201
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    ATGAATAACGGTACAGTTAAATGGTTTAATGCAGAAAAAGGTTTTGGTTTCATCGAAAGA
    GAAGATGGTAGCGACGTATTCGTACACTTCTCAGCAATCGCTGAAGATGGATACAAATCA
    TTAGAAGAAGGCCAAAAAGTTGAATTCGACATCGTTGAAGGCGACCGTGGCGAGCAAGCT
    GCAAACGTAGTTAAAATGTAA
    60
    120
    180
    201


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: NWMN_0761 [new locus tag: NWMN_RS04305 ]
  • symbol: CspC
  • description: cold-shock protein CSD family protein
  • length: 66
  • theoretical pI: 4.18132
  • theoretical MW: 7374.06
  • GRAVY: -0.513636

⊟Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Adaptations to atypical conditions cold shock domain protein CspD (TIGR02381; HMM-score: 91.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair cold shock domain protein CspD (TIGR02381; HMM-score: 91.9)
    and 1 more
    Genetic information processing Transcription Degradation of RNA VacB and RNase II family 3'-5' exoribonucleases (TIGR00358; EC 3.1.13.1; HMM-score: 12.1)
  • TheSEED  :
    • Cold shock protein of CSP family
    Stress Response Cold shock Cold shock, CspA family of proteins  Cold shock protein CspC
  • PFAM:
    OB (CL0021) CSD; 'Cold-shock' DNA-binding domain (PF00313; HMM-score: 110)
    and 4 more
    S1; S1 RNA binding domain (PF00575; HMM-score: 18)
    CSDE1; Cold shock domain-containing protein E1 CSD domain (PF23456; HMM-score: 17.4)
    S1CSD-TOTE-2; S1/CSD-like domain 2 of the TOTE conflict systems (PF22707; HMM-score: 16.8)
    OB_RNB; Ribonuclease B OB domain (PF08206; HMM-score: 15.7)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9996
    • Cytoplasmic Membrane Score: 0
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0004
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004502
    • TAT(Tat/SPI): 0.000512
    • LIPO(Sec/SPII): 0.000655
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNNGTVKWFNAEKGFGFIEREDGSDVFVHFSAIAEDGYKSLEEGQKVEFDIVEGDRGEQAANVVKM

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]


⊟Relevant publications[edit | edit source]